Previous Contig 007159:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002N11Sequence259007159 (2)gb:AP003284_18272492e-04Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067721022046gb:AK117477_18155105e-33Arabidopsis thaliana At1g60550 mRNA for putative enoyl-CoA hydratase/isomerase,
JMSF037I23Sequence627007159 (2)gb:AP003284_18272491e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P067698023772pir|G96630|G966309e-48probable enoyl-CoA hydratase/isomerase [imported] - Arabidopsis thaliana>gb:AE00

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037I23+ CACTAAAAATAAATAAAAATTTCTTCT
                      ____________________________________________________________
consensus CACTAAAAATAAATAAAAATTTCTTCT
 
. : . : . : . : . : . :
JMSF037I23+ TTAACCCAATTTTCAGCAATCCCAACCTCAGACAGTAGTGTAATCAACACTGTTTCAAAT
                      ____________________________________________________________
consensus TTAACCCAATTTTCAGCAATCCCAACCTCAGACAGTAGTGTAATCAACACTGTTTCAAAT
 
. : . : . : . : . : . :
JMSF037I23+ AGTTAGATATTGTTGAAAACCTATGAAATTATAGATCATCTTTCTTTTTTCTGTATCAAA
                      ____________________________________________________________
consensus AGTTAGATATTGTTGAAAACCTATGAAATTATAGATCATCTTTCTTTTTTCTGTATCAAA
 
. : . : . : . : . : . :
JMSF037I23+ TATGAGAAATTAGTAGAATTACAGAGTTACCTTCCCTGTGAGAATGATGACCCCCACAGA
                      ____________________________________________________________
consensus TATGAGAAATTAGTAGAATTACAGAGTTACCTTCCCTGTGAGAATGATGACCCCCACAGA
 
. : . : . : . : . : . :
JMSF037I23+ ACCATCATCCCTGGCATCATTAAATGCACGAATAAGTTCCTTAACTGTATGAGGCCTGAA
                      ____________________________________________________________
consensus ACCATCATCCCTGGCATCATTAAATGCACGAATAAGTTCCTTAACTGTATGAGGCCTGAA
 
. : . : . : . : . : . :
JMSF037I23+ AGCATTCCTTCTTTCTGGTCTATTAATGGTTATCTTAGCAATGGCTTCTCCGACGGCTTT
                      ____________________________________________________________
consensus AGCATTCCTTCTTTCTGGTCTATTAATGGTTATCTTAGCAATGGCTTCTCCGACGGCTTT
 
. : . : . : . : . : . :
JMSF002N11+ TCGTAGATGATATCAGTGAAGTCCTTGCCGGAGTCATCGGAAGGGACCAATCTCCAAGC
JMSF037I23+ CTCGTAGATGATATCAGTGAAGTCCTTGCCGGAGTCATCGGAAGGGACCAATCTCCAAGC
                      ____________________________________________________________
consensus CTCGTAGATGATATCAGTGAAGTCCTTGCCGGAGTCATCGGAAGGGACCAATCTCCAAGC
 
. : . : . : . : . : . :
JMSF002N11+ GGGCGCGTGAGCGGGGACTTCGCCGTGAACTCTGTGGTAGGTGTCGTTGATGGACGAGCT
JMSF037I23+ GGGCGCGTGAGCGGGGACTTCGCCGTGAACTCTGTGGTAGGTGTCGTTGATGGACGAGCT
                      ____________________________________________________________
consensus GGGCGCGTGAGCGGGGACTTCGCCGTGAACTCTGTGGTAGGTGTCGTTGATGGACGAGCT
 
. : . : . : . : . : . :
JMSF002N11+ GCAACTCGAGGAGCCAATTGAGGGGAGAGAAGAGCAGGGAGGTGGTTGCGGCGGCAGGAG
JMSF037I23+ GCAACTCGAGGAGCCAATTGAGGGGAGAGAAGAGCAGGGAGGTGGTTGCGGCGGCAGGAG
                      ____________________________________________________________
consensus GCAACTCGAGGAGCCAATTGAGGGGAGAGAAGAGCAGGGAGGTGGTTGCGGCGGCAGGAG
 
. : . : . : . : . : . :
JMSF002N11+ GTGATTGGCGACGGACGCCACCCTCCTTGTGACGGTGGTGATGAGGGCCTTCTCTGATGC
JMSF037I23+ GTGATTGGCGACGGACGCCACCCTCCTTGTGACGGTGGTGATGAGGGCCTTCTCTGATGC
                      ____________________________________________________________
consensus GTGATTGGCGACGGACGCCACCCTCCTTGTGACGGTGGTGATGAGGGCCTTCTCTGATGC
 
. : . : . : . : . : . :
JMSF002N11+ TCCCGACATTGCTCGGCGT
JMSF037I23+ TCCCGACATTGCTCGGCGTAGTGAGTGGGTGGTTCCCACGGAATTTGAAGAAGAGCAGCC
                      ____________________________________________________________
consensus TCCCGACATTGCTCGGCGTAGTGAGTGGGTGGTTCCCACGGAATTTGAAGAAGAGCAGCC