Previous Contig 007158:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003P10Sequence308007158 (14)gb:AY058069_15642087e-13Arabidopsis thaliana At2g46080/T3F17.27 mRNA, complete cds.712007158 (14)pir|E84898|E848986e-36hypothetical protein At2g46080 [imported] - Arabidopsis thaliana>gb:AC005397_153
JMFF012M09Sequence518007158 (14)gb:AY058069_15642082e-32Arabidopsis thaliana At2g46080/T3F17.27 mRNA, complete cds.711007158 (14)pir|E84898|E848982e-38hypothetical protein At2g46080 [imported] - Arabidopsis thaliana>gb:AC005397_153
JMFF029I24Sequence573007158 (14)gb:AY058069_15642081e-38Arabidopsis thaliana At2g46080/T3F17.27 mRNA, complete cds.650007158 (14)gb:AY058069_15642087e-29Arabidopsis thaliana At2g46080/T3F17.27 mRNA, complete cds.
JMFS015A05Sequence578007158 (14)pir|E84898|E848981e-53hypothetical protein At2g46080 [imported] - Arabidopsis thaliana>gb:AC005397_153
JMFS015A06Sequence527007158 (14)pir|E84898|E848981e-49hypothetical protein At2g46080 [imported] - Arabidopsis thaliana>gb:AC005397_153
JMSF023P24Sequence636007158 (14)gb:AY058069_15642083e-44Arabidopsis thaliana At2g46080/T3F17.27 mRNA, complete cds.672007158 (14)pir|E84898|E848984e-36hypothetical protein At2g46080 [imported] - Arabidopsis thaliana>gb:AC005397_153
JMSF024G04Sequence675007158 (14)gb:AY058069_15642084e-48Arabidopsis thaliana At2g46080/T3F17.27 mRNA, complete cds.774007158 (14)pir|E84898|E848987e-41hypothetical protein At2g46080 [imported] - Arabidopsis thaliana>gb:AC005397_153
JMSF037I14Sequence615007158 (14)gb:AY058069_15642084e-20Arabidopsis thaliana At2g46080/T3F17.27 mRNA, complete cds.717007158 (14)pir|E84898|E848986e-36hypothetical protein At2g46080 [imported] - Arabidopsis thaliana>gb:AC005397_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF023P24- CAAAACATGTAAA
rJMFF012M09- TCATTACAATAGTAAAAGTGTACAAAACATGTAAA
rJMFF029I24- CTTATATACATCATTACAATAGTAAAAGTGTACAAAACATGTAAA
rJMFF003P10- AAATATACTTATATACATCATTACAATAGTAAAAGTGTACAAAACATGTAAA
rJMSF037I14- AAATATACTTATATACATCATTACAATAGTAAAAGTGTACAAAACATGTAAA
rJMSF024G04- TAGCAGCAAATATACTTATATACATCATTACAATAGTAAAAGTGTACAAAACATGTAAA
                      ____________________________________________________________
consensus TAGCAGCAAATATACTTATATACATCATTACAATAGTAAAAGTGTACAAAACATGTAAA
 
. : . : . : . : . : . :
rJMSF023P24- TATTATGACATTATCAGACCACAAATGACTACTAATATCACAATTGCTGACACATACTGT
rJMFF012M09- TATTATGACATTATCAGACCACAAATGACTACTAATATCACAATTGCTGACACATACTGT
rJMFF029I24- TATTATGACATTATCAGACCACAAATGACTACTAATATCACAATTGCTGACACATACTGT
rJMFF003P10- TATTATGACATTATCAGACCACAAATGACTACTAATATCACAATTGCTGACACATACTGT
rJMSF037I14- TATTATGACATTATCAGACCACAAATGACTACTAATATCACAATTGCTGACACATACTGT
rJMSF024G04- TATTATGACATTATCAGACCACAAATGACTACTAATATCACAATTGCTGACACATACTGT
                      ____________________________________________________________
consensus TATTATGACATTATCAGACCACAAATGACTACTAATATCACAATTGCTGACACATACTGT
 
. : . : . : . : . : . :
rJMSF023P24- ACTACTATGCGCTACTATATATTCAACACAGTAACAGGAAACCGCACATTTTAACCCCTT
rJMFF012M09- ACTACTATGCGCTACTATATATTCAACACAGTAACAGGAAACCGCACATTTTAACCCCTT
rJMFF029I24- ACTACTATGCGCTACTATATATTCAACACAGTAACAGGAAACCGCACATTTTAACCCCTT
rJMFF003P10- ACTACTATGCGCTACTATATATTCAACACAGTAACAGGAAACCGCACATTTTAACCCCTT
rJMSF037I14- ACTACTATGCGCTACTATATATTCAACACAGTAACAGGAAACCGCACATTTTAACCCCTT
rJMSF024G04- ACTACTATGCGCTACTATATATTCAACACAGTAACAGGAAACCGCACATTTTAACCCCTT
                      ____________________________________________________________
consensus ACTACTATGCGCTACTATATATTCAACACAGTAACAGGAAACCGCACATTTTAACCCCTT
 
. : . : . : . : . : . :
rJMSF023P24- TGCATACAGATGATCATAGTCAACATACATATTACCAAAGAGTCACCTCAGAGTTGGCTG
rJMFF012M09- TGCATACAGATGATCATAGTCAACATACATATTACCAAAGAGTCACCTCAGAGTTGGCTG
rJMFF029I24- TGCATACAGATGATCATAGTCAACATACATATTACCAAAGAGTCACCTCAGAGTTGGCTG
rJMFF003P10- TGCATACAGATGATCATAGTCAACATACATATTACCAAAGAGTCACCTCAGAGTTGGCTG
rJMSF037I14- TGCATACAGATGATCATAGTCAACATACATATTACCAAAGAGTCACCTCAGAGTTGGCTG
rJMSF024G04- TGCATACAGATGATCATAGTCAACATACATATTACCAAAGAGTCACCTCAGAGTTGGCTG
                      ____________________________________________________________
consensus TGCATACAGATGATCATAGTCAACATACATATTACCAAAGAGTCACCTCAGAGTTGGCTG
 
. : . : . : . : . : . :
rJMSF023P24- TTCTGCATTGTTCTCTTGTGATGGGCTGGCATTGTTGCTCCCAATTCTTAGGTTACAAAG
rJMFF012M09- TTCTGCATTGTTCTCTTGTGATGGGCTGGCATTGTTGCTCCCAATTCTTAGGTTACAAAG
rJMFF029I24- TTCTGCATTGTTCTCTTGTGATGGGCTGGCATTGTTGCTCCCAATTCTTAGGTTACAAAG
rJMFF003P10- TTCTGCATTGTTCTCTTGTGATGGGCTGGCATTGTTGCTCCCAATTCTTAGGTTACAAAG
rJMSF037I14- TTCTGCATTGTTCTCTTGTGATGGGCTGGCATTGTTGCTCCCAATTCTTAGGTTACAAAG
rJMSF024G04- TTCTGCATTGTTCTCTTGTGATGGGCTGGCATTGTTGCTCCCAATTCTTAGGTTACAAAG
                      ____________________________________________________________
consensus TTCTGCATTGTTCTCTTGTGATGGGCTGGCATTGTTGCTCCCAATTCTTAGGTTACAAAG
 
. : . : . : . : . : . :
rJMSF023P24- CAAAGCATCACGTCCAGTAAGAACAATTTGGAAGAATCCATCAACTTCCTTTGCCAAACC
rJMFF012M09- CAAAGCATCACGTCCAGTAAGAACAATTTGGAAGAATCCATCAACTTCCTTTGCCAAACC
rJMFF029I24- CAAAGCATCACGTCCAGTAAGAACAATTTGGAAGAATCCATCAACTTCCTTTGCCAAACC
rJMFF003P10- CAAAGCATCACGTCCAGTAAGAACAATTTGGAAGAATCCATCAACTTCCTTTGCCAAACC
rJMSF037I14- CAAAGCATCACGTCCAGTAAGAGCAATTTGGAAGAATCCATCAACTTCCTTTGCCAAACC
rJMSF024G04- CAAAGCATCACGTCCAGTAAGAACAATTTGGAAGAATCCATCAACTTCCTTTGCCAAACC
                      ____________________________________________________________
consensus CAAAGCATCACGTCCAGTAAGAACAATTTGGAAGAATCCATCAACTTCCTTTGCCAAACC
 
. : . : . : . : . : . :
rJMSF023P24- ATCGAGTCCTTTGGAAAGTCGATCTGCCATCTTTGCCAAACCTGAAGTCTCGTGTGGCAA
rJMFF012M09- ATCGAGTCCTTTGGAAAGTCGATCTGCCATCTTTGCCAAACCTGAAGTCTCGTGTGGCAA
rJMFF029I24- ATCGAGTCCTTTGGAAAGTCGATCTGCCATCTTTGCCAAACCTGAAGTCTCGTGTGGCAA
rJMFF003P10- ATCGAGTCCTTTGGAAAGTCGATCTGCCATCTTTGCCAAACCTGAAGTCTCGTGTGGCAA
rJMSF037I14- ATCGAGTCCTTTGGAAAGTCGATCTGCCATCTTTGCCAAACCTGAAGTCTCGTGTGGCAA
rJMSF024G04- ATCGAGTCCTTTGGAAAGTCGATCTGCCATCTTTGCCAAACCTGAAGTCTCGTGTGGCAA
                      ____________________________________________________________
consensus ATCGAGTCCTTTGGAAAGTCGATCTGCCATCTTTGCCAAACCTGAAGTCTCGTGTGGCAA
 
. : . : . : . : . : . :
rJMSF023P24- TATATCAGCTCCGATAGGGTTTACTCCATCCTGTATGATGGGATGCAGTTTCTCCACACT
rJMFF012M09- TACATCAGCTCCGATAGGGTTTACTCCATCCTGTATGATGGGATGCAGTTTCTCCACACT
rJMFF029I24- TACATCAGCTCCGATAGGGTTTACTCCATCCTGTATGATGGGATGCAGTTTCTCCACACT
rJMFF003P10- TACATCAGCTCCGATAGGGTTTACTCCATCCTGTATGATGGGATGCAGTTTCTCCACACT
rJMSF037I14- TACATCAGCTCCGATAGGGTTTACTCCATCCTGTATGATGGGATGCAGTTTCTCCACACT
rJMSF024G04- TACATCAGCTCCGATAGGGTTTACTCCATCCTGTATGATGGGATGCAGTTTCTCCACACT
                      ____________________________________________________________
consensus TACATCAGCTCCGATAGGGTTTACTCCATCCTGTATGATGGGATGCAGTTTCTCCACACT
 
. : . : . : . : . : . :
rJMSF023P24- TGCATGAATGGCTTCAAGGTCCTTCAATGCTGTTGCTGCTCCACTAGAATATATGTTCCT
rJMFF012M09- TGCATGAATGGCTTCAAGGTCCTTCAATGCTGTTGCTGCTCCACTAGAATATATGTTCCT
rJMFF029I24- TGCATGAATGGCTTCAAGGTCCTTCAATGCTGTTGCTGCTCCACTAGAATATATGTTCCT
rJMFF003P10- TGCATGAATGGCTTCAAGGTCCTTCAATGCTGTTGCTGCTCCACTAGAATATATGTTCCT
rJMSF037I14- TGCATGAATGGCTTCAAGGTCCTTCAATGCTGTTGCTGCTCCACTAGAATATATGTTCCT
rJMSF024G04- TGCATGAATGGCTTCAAGGTCCTTCAATGCTGTTGCTGCTCCACTAGAATATATGTTCCT
                      ____________________________________________________________
consensus TGCATGAATGGCTTCAAGGTCCTTCAATGCTGTTGCTGCTCCACTAGAATATATGTTCCT
 
. : . : . : . : . : . :
rJMSF023P24- CATTTCCCTGTTAATGAAACCCTGCAGATCAACATAAGCATCGGCCCATAGGCAAGTCTC
rJMFF012M09- CATTTCCCTGTTAATGAAACCCTGCAGATCAACATAAGCATCGGCCCATAGGCAAGTCTC
rJMFF029I24- CATTTCCCTGTTAATGAAACCCTGCAGATCAACATAAGCATCGGCCCATAGGCAAGTCTC
rJMFF003P10- CATTTCCCTGTTAATGAAACCCTGCAGATCAACATAAGCATCGGCCCATAGGCAAGTCTC
rJMSF037I14- CATTTCCCTGTTAATGAAACCCTGCAGATCAACATAAGCATCGGCCCATAGGCAAGTCTC
rJMSF024G04- CATTTCCCTGTTAATGAAACCCTGCAGATCAACATAAGCATCGGCCCATAGGCAAGTCTC
JMFS015A05+ AACCCTGCAGATCAACATAAGCATCGGCCCATAGGCAAGTCTC
                      ____________________________________________________________
consensus CATTTCCCTGTTAATGAAACCCTGCAGATCAACATAAGCATCGGCCCATAGGCAAGTCTC
 
. : . : . : . : . : . :
rJMSF023P24- GAGGACCTCTAGCTCCTTCAAGTTGCCCACAGACCCTGAGAAAGCAACAGCAAACACACT
rJMFF012M09- GAGGACCTCTAGCTCCTTCAAGTTGCCCACAGACCCTGAGAAAGCAACAGCAAACACACT
rJMFF029I24- GAGGACCTCTAGCTCCTTCAAGTTGCCCACAGACCCTGAGAAAGCAACAGCAAACACACT
rJMFF003P10- GAGGACCTCTAGCTCCTTCAAGTTGCCCACAGACCCTGAGAAAGCAACAGCAAACACACT
rJMSF037I14- GAGGACCTCTAGCTCCTTCAAGTTGCCCACAGACCCTGAGAAAGCAACAGCAAACACACT
rJMSF024G04- GAGGACCTCTAGCTCCTTCAAGTTGCCCACAGACCCTGAGAAAGCAACAGCAAACACACT
JMFS015A05+ GAGGACCTCTAGCTCCTTCAAGTTGCCCACAGACCCTGAGAAAGCAACAGCAAACACACT
JMFS015A06+ TAGCTCCTTCAAGTTGCCCACAGACCCTGAGAAAGCAACAGCAAACACACT
                      ____________________________________________________________
consensus GAGGACCTCTAGCTCCTTCAAGTTGCCCACAGACCCTGAGAAAGCAACAGCAAACACACT
 
. : . : . : . : . : . :
rJMSF023P24- GCAAATGAAAATGGTTACCATCCGGACTCCATACAAAGCTTGCATCAAAACCTTCCCTT
rJMFF012M09- GCAAATGAAAATGGTTACCATCCGGACTCCATACAAAGCTTGCATCAAAACCTTCCCTTT
rJMFF029I24- GCAAA
rJMFF003P10- GCAAATGAAAATGGTTACCATCCGGACTCCATACAAAGCTTGCATCAAAACCTTCCC
rJMSF037I14- GCAAATGAAAATGGTTACCATCCGGACTCCATACAAAGCTTGCATCAAAACCTTCCCT
rJMSF024G04- GCAAATGAAAATGGTTACCATCCGGACTCCATACAAAGCTTGCATCAAAACCTTCCCTTT
JMFS015A05+ GCAAATGAAAATGGTTACCATCCGGACTCCATACAAAGCTTGCATCAAAACCTTCCCTTT
JMFS015A06+ GCAAATGAAAATGGTTACCATCCGGACTCCATACAAAGCTTGCATCAAAACCTTCCCTTT
                      ____________________________________________________________
consensus GCAAATGAAAATGGTTACCATCCGGACTCCATACAAAGCTTGCATCAAAACCTTCCCTTT
 
. : . : . : . : . : . :
rJMFF012M09- TGCAGAATTTTTTATC
rJMSF024G04- TGCAGAATTTTTTATCTTAGGTAAGTTC-AACTTTCAGTGAGGGTGTTCA
JMFS015A05+ TGCAGAATTTTTTATCTTAGGTAAGTTCAAACTTTCAGTGAGGGTGTTCAACTTCTCAAA
JMFS015A06+ TGCAGAATTTTTTATCTTAGGTAAGTTCAAACTTTCAGTGAGGGTGTTCAACTTCTCAAA
JMSF024G04+ TGAGGGTGTTCNACTTCTCAAA
                      ____________________________________________________________
consensus TGCAGAATTTTTTATCTTAGGTAAGTTCAAACTTTCAGTGAGGGTGTTCAACTTCTCAAA
 
. : . : . : . : . : . :
JMFS015A05+ GCATCGCTCCAATCTTGGATTTTGAGAATTCATATGCTGCCTCCATCCATTCAATGATGA
JMFS015A06+ GCATCGCTCCAATCTTGGATTTTGAGAATTCATATGCTGCCTCCATCCATTCAATGATGA
JMSF024G04+ GCATCGCTCCAATCTTGGATTTTGAGAATTCATATGCTGCCTCCATCCATTCAATGATGA
JMSF023P24+ TTTGAGAATTCATATGCTGCCTCCATCCATTCAATGATGA
                      ____________________________________________________________
consensus GCATCGCTCCAATCTTGGATTTTGAGAATTCATATGCTGCCTCCATCCATTCAATGATGA
 
. : . : . : . : . : . :
JMFS015A05+ GCATGCTTGCATAATTTGTTTTTCTTCACCCTCCAGGTAATGCACAGCACAGCTAAGAAA
JMFS015A06+ GCATGCTTGCATAATTTGTTTTTCTTCACCCTCCAGGTAATGCACAGCACAGCTAAGAAA
JMSF024G04+ GCATGCTTGCATAATTTGTTTTTCTTCACCCTCCAGGTAATGCACAGCACAGCTAAGAAA
JMFF029I24+ CCCTCCAGGTAATGCACAGCACAGCTAAGAAA
JMSF023P24+ GCATGCTTGCATAATTTGTTTTTCTTCACCCTCCAGGTAATGCACAGCACAGCTAAGAAA
                      ____________________________________________________________
consensus GCATGCTTGCATAATTTGTTTTTCTTCACCCTCCAGGTAATGCACAGCACAGCTAAGAAA
 
. : . : . : . : . : . :
JMFS015A05+ AAGATTGGCTTGGTTGATCCTTGTGATCTCAGAGCTGATAGAAGTACAAATATCCAGTAA
JMFS015A06+ AAGATTGGCTTGGTTGATCCTTGTGATCTCAGAGCTGATAGAAGTACAAATATCCAGTAA
JMSF024G04+ AAGATTGGCTTGGTTGATCCTTGTGATCTCAGAGCTGATAGAAGTACAAATATCCAGTAA
JMFF029I24+ AAGATTGGCTTGGTTGATCCTTGTGATCTCAGAGCTGATAGAAGTACAAATATCCAGTAA
JMSF023P24+ AAGATTGGCTTGGTTGATCCTTGTGATCTCAGAGCTGATAGAAGTACAAATATCCAGTAA
JMFF012M09+ TGTGATCTCAGAGCTGATAGAAGTACAAATATCCAGTAA
                      ____________________________________________________________
consensus AAGATTGGCTTGGTTGATCCTTGTGATCTCAGAGCTGATAGAAGTACAAATATCCAGTAA
 
. : . : . : . : . : . :
JMFS015A05+ CCTCACACTGTTGTCCAAGTACACATCAATCCACTTCTCATCCCAATCAGATACAGGAAA
JMFS015A06+ CCTCACACTGTTGTCCAAGTACACATCAATCCACTTCTCATCCCAATCAGATACAGGAAA
JMSF024G04+ CCTCACACTGTTGTCCAAGTACACATCAATCCACTTCTCATCCCAATCAGATACAGGAAA
JMFF029I24+ CCTCACACTGTTGTCCAAGTACACATCAATCCACTTCTCATCCCAATCAGATACAGGAAA
JMSF023P24+ CCTCACACTGTTGTCCAAGTACACATCAATCCACTTCTCATCCCAATCAGATACAGGAAA
JMFF012M09+ CCTCACACTGTTGTCCAAGTACACATCAATCCACTTCTCATCCCAATCAGATACAGGAAA
JMSF037I14+ CCAATCAGATACAGGAAA
                      ____________________________________________________________
consensus CCTCACACTGTTGTCCAAGTACACATCAATCCACTTCTCATCCCAATCAGATACAGGAAA
 
. : . : . : . : . : . :
JMFS015A05+ TTCAAGTGCAGTTATAAGTTCTTTAGTTTCTATATGGATTTGAGAAAGTGAAACAATTGC
JMFS015A06+ TTCAAGTGCAGTTATAAGTTCTTTAGTTTCTATATGGATTTGAGAAAGTGAAACAATTGC
JMSF024G04+ TTCAAGTGCAGTTATAAGTTCTTTAGTTTCTATATGGATTTGAGAAAGTGAAACAATTGC
JMFF029I24+ TTCAAGTGCAGTTATAAGTTCTTTAGTTTCTATATGGATTTGAGAAAGTGAAACAATTGC
JMSF023P24+ TTCAAGTGCAGTTATAAGTTCTTTAGTTTCTATATGGATTTGAGAAAGTGAAACAATTGC
JMFF003P10+ ACAATTGC
JMFF012M09+ TTCAAGTGCAGTTATAAGTTCTTTAGTTTCTATATGGATTTGAGAAAGTGAAACAATTGC
JMSF037I14+ TTCAAGTGCAGTTATAAGTTCTTTAGTTTCTATATGGATTTGAGAAAGTGAAACAATTGC
                      ____________________________________________________________
consensus TTCAAGTGCAGTTATAAGTTCTTTAGTTTCTATATGGATTTGAGAAAGTGAAACAATTGC
 
. : . : . : . : . : . :
JMFS015A05+ TTGCTGCATCCATAATAAGCTTATGACATCTTCCCCGCCTCCAGGAATGAGACTT
JMFS015A06+ TTGCTGCATCCATAATAAGCTTATGACATCTTCCCCGCCTCCAGGAATGAGACTTT
JMSF024G04+ TTGCTGCATCCATAATAAGCTTATGACATCTTCCCCGCCTCCAGGAATGAGACTTTTAAG
JMFF029I24+ TTGCTGCATCCATAATAAGCTTATGACATCTTCCCCGCCTCCAGGAATGAGACTTTTAAG
JMSF023P24+ TTGCTGCATCCATAATAAGCTTATGACATCTTCCCCGCCTCCAGGAATGAGACTTTTAAG
JMFF003P10+ TTGCTGCATCCATAATAAGCTTATGACATGTTCCCCGCCTCCAGGAATGAGACTTTTAAG
JMFF012M09+ TTGCTGCATCCATAATAAGCTTATGACATCTTCCCCGCCTCCAGGAATGAGACTTTTAAG
JMSF037I14+ TTGCTGCATCCATAATAAGCTTATGACATCTTCCCCGCCTCCAGGAATGAGACTTTTAAG
                      ____________________________________________________________
consensus TTGCTGCATCCATAATAAGCTTATGACATCTTCCCCGCCTCCAGGAATGAGACTTTTAAG
 
. : . : . : . : . : . :
JMSF024G04+ CTTACCTGCCAATGACTCCTCAAAAGACTTCAACAAAGAAATAAGTCTTGGAGACAGGTG
JMFF029I24+ CTTACCTGCCAATGACTCCTCAAAAGACTTCAACAAAGAAATAAGTCTTGGAGACAGGTG
JMSF023P24+ CTTACCTGCCAATGACTCCTCAAAAGACTTCAACAAAGAAATAAGTCTTGGAGACAGGTG
JMFF003P10+ CTTACCTGCCAATGACTCCTCAAAAGACTTCAACAAAGAAATAAGTCTTGGAGACAGGTG
JMFF012M09+ CTTACCTGCCAATGACTCCTCAAAAGACTTCAACAAAGAAATAAGTCTTGGAGACAGGTG
JMSF037I14+ CTTACCTGCCAATGACTCCTCAAAAGACTTCAACAAAGAAATAAGTCTTGGAGACAGGTG
                      ____________________________________________________________
consensus CTTACCTGCCAATGACTCCTCAAAAGACTTCAACAAAGAAATAAGTCTTGGAGACAGGTG
 
. : . : . : . : . : . :
JMSF024G04+ TGAGCCCTTAGGTAATATCATTCTGAGGGGATTTCCAAACGAGAAAAATGGTCGGTGTGG
JMFF029I24+ TGAGCCCTTAGGTAATATCATTCTGAGGGGATTTCCAAACGAGAAAAATGGTCGGTGTGG
JMSF023P24+ TGAGCCCTTAGGTAATATCATTCTGAGGGGATTTCCAAACGAGAAAAATGGTCGGTGTGG
JMFF003P10+ TGAGCCCTTAGGTAATATCATTCTGAGGGGATTTCCAAACGAGAAAAATGGTCGGTGTGG
JMFF012M09+ TGAGCCCTTAGGTAATATCATTCTGAGGGGATTTCCAAACGAGAAAAATGGTCGGTGTGG
JMSF037I14+ TGAGCCCTTAGGTAATATCATTCTGAGGGGATTTCCAAACGAGAAAAATGGTCGGTGTGG
                      ____________________________________________________________
consensus TGAGCCCTTAGGTAATATCATTCTGAGGGGATTTCCAAACGAGAAAAATGGTCGGTGTGG
 
. : . : . : . : . : . :
JMSF024G04+ CTCCTGTGGACGACTCATTTCGTACAAGTAATATACAGAAACAAACGTTTTGCTATTCAA
JMFF029I24+ CTCCTGTGGACGACTCATTTCGTACAAGTAATATACAGAAACAAACGTTTTGCTATTCAA
JMSF023P24+ CTCCTGTGGACGACTCATTTCGTACAAGTAATATACAGAAACAAACGTTTTGCTATTCAA
JMFF003P10+ CTCCTGTGGACGACTCATTTCGTACAAGTAATATACAGAAACAAACGTTTTGCTATTCAA
JMFF012M09+ CTCCTGTGGACGACTCATTTCGTACAAGTAATATACAGAAACAAACGTTTTGCTATTCAA
JMSF037I14+ CTCCTGTGGACGACTCATTTCGTACAAGTAATATACAGAAACAAACGTTTTGCTATTCAA
                      ____________________________________________________________
consensus CTCCTGTGGACGACTCATTTCGTACAAGTAATATACAGAAACAAACGTTTTGCTATTCAA
 
. : . : . : . : . : . :
JMSF024G04+ ATCTGAAGCCGATCCAGACGGTCAAATCCAACGATTCAAACTAAGCTGAGCGAATAATAT
JMFF029I24+ ATCTGAAGCCGATCCAGACGGTCAAATCCAACGATTCAAACTAAGCT
JMSF023P24+ ATCTGAAGCCGATCCAGACGGTCAAATCCAACGATTCAAACTAAGCTGAGCGAATAATAT
JMFF003P10+ ATCTGAAGCCGATCCAGACGGTCAAATCCAACGATTCAAACTAAGCTGAGCGAATAATAT
JMFF012M09+ ATCTGAAGCCGATCCAGACGGTCAAATCCAACGATTCAAACTAAGCTGAGCGAATAATAT
JMSF037I14+ ATCTGAAGCCGATCCAGACGGTCAAATCCAACGATTCAAACTAAGCTAA---ATCAAGAT
                      ____________________________________________________________
consensus ATCTGAAGCCGATCCAGACGGTCAAATCCAACGATTCAAACTAAGCTGAGCGAATAATAT
 
. : . : . : . : . : . :
JMSF024G04+ ACGGATACAGAGAGGCGAAGTCGGTAGAATATTAGCCGCAGACGGCGCTTG
JMSF023P24+ ACGGATACAGAGAGGCGAAGTCGGTAGAATATTAGCCGCAGACGGCGCTTG
JMFF012M09+ ACGGATACAGAGAGGCGAAGTCGGTAGAATATTAGCCGCAGACGGCGCTTG
JMSF037I14+ GCCAAATTCAAACCCTGAGTTATACACAAGCATACATACACAAAACAGTAGATATATTAC
                      ____________________________________________________________
consensus ACGGATACAGAGAGGCGAAGTCGGTAGAATATTAGCCGCAGACGGCGCTTGATATATTAC
 
. : . : . : . : . : . :
JMSF037I14+ ACACGCGAAGAGGAAGAGACCGTACCTGAGCGAATAATATACGGATACAGAGAGGCGAAG
                      ____________________________________________________________
consensus ACACGCGAAGAGGAAGAGACCGTACCTGAGCGAATAATATACGGATACAGAGAGGCGAAG
 
. : . : . : . : . : . :
JMSF037I14+ TCGGTAGAATATTAGCCGCAGACGGCGCTTGCGATAAGGGTTTCGCACAAGTATTGACAA
                      ____________________________________________________________
consensus TCGGTAGAATATTAGCCGCAGACGGCGCTTGCGATAAGGGTTTCGCACAAGTATTGACAA
 
. : . : . : . : . : . :
JMSF037I14+ ATGACAATATAGGGTTTCGTATCCTTAGATGATAAAATGACCGTTGAAATGGTGCGTTTC
                      ____________________________________________________________
consensus ATGACAATATAGGGTTTCGTATCCTTAGATGATAAAATGACCGTTGAAATGGTGCGTTTC