Previous Contig 007153:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF037G24Sequence684007153 (2)gb:BT001983_16355862e-37Arabidopsis thaliana putative Na+-dependent inorganic phosphate cotransporter (A663013161 (3)gb:AP000815_18206192e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0003H10
JMSF038G24Sequence583007153 (2)gb:BT001983_16355861e-24Arabidopsis thaliana putative Na+-dependent inorganic phosphate cotransporter (A822013161 (3)gb:AP000815_18206191e-53Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0003H10

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037G24+ GCTGCAATTGGTGTGAGGATNGTA
                      ____________________________________________________________
consensus GCTGCAATTGGTGTGAGGATNGTA
 
. : . : . : . : . : . :
JMSF037G24+ GCTATAGACCACCAAACTACACCAAATCCTAAGACAAGCTTCCCTCCAACCGTGTCAGCC
                      ____________________________________________________________
consensus GCTATAGACCACCAAACTACACCAAATCCTAAGACAAGCTTCCCTCCAACCGTGTCAGCC
 
. : . : . : . : . : . :
JMSF038G24+ CTGAGTTAAAAGATAGCCCCAGAAAAAGGAAGATTGTATCAAA
JMSF037G24+ CATATTCCCCCTGCAATCTGAGTTAAAAGATAGCCCCAGAAAAAGGAAGATTGTATCAAA
                      ____________________________________________________________
consensus CATATTCCCCCTGCAATCTGAGTTAAAAGATAGCCCCAGAAAAAGGAAGATTGTATCAAA
 
. : . : . : . : . : . :
JMSF038G24+ CCAACAGTCGTAGGACTCCAATGATATTCTGATGCCATTGGAAGTATGGCTATGCTCATG
JMSF037G24+ CCAACAGTCGTAGGACTCCAATGATATTCTGATGCCATTGGAAGTATGGCTATGCTCATG
                      ____________________________________________________________
consensus CCAACAGTCGTAGGACTCCAATGATATTCTGATGCCATTGGAAGTATGGCTATGCTCATG
 
. : . : . : . : . : . :
JMSF038G24+ TTTACTCTATCCATATTGCAAAGTAGAAAAGCGGAGAAACAGAGAAGCTCGATAACCCAA
JMSF037G24+ TTTACTCTATCCATATTGCAAAGTAGAAAAGCGGAGAAACAGAGAAGCACGATAACCCAA
                      ____________________________________________________________
consensus TTTACTCTATCCATATTGCAAAGTAGAAAAGCGGAGAAACAGAGAAGCTCGATAACCCAA
 
. : . : . : . : . : . :
JMSF038G24+ CGCTTGGGGAATCCCCCCGATATGGTCTCACCATCATCCTCCGTCAATACGTCGTNGTTG
JMSF037G24+ CGCTTGGGGAATCCCCCCGATATGGTCTCACCATCATCCTCCGTCAATACGTCGTCGTTG
                      ____________________________________________________________
consensus CGCTTGGGGAATCCCCCCGATATGGTCTCACCATCATCCTCCGTCAATACGTCGTCGTTG
 
. : . : . : . : . : . :
JMSF038G24+ AGAGCATCTTCAAACTTGAGAGATTCCGGCACCGAGTCCGAAATNCCATACGTTTTGGAC
JMSF037G24+ AGAGCATCTTCAAACTTGAGAGATTCCGGCACCGAGTCCGAAATGCCATACGTTTTGGAC
                      ____________________________________________________________
consensus AGAGCATCTTCAAACTTGAGAGATTCCGGCACCGAGTCCGAAATGCCATACGTTTTGGAC
 
. : . : . : . : . : . :
JMSF038G24+ TTGACATCCGCCCATGCCCTCCAACTCGTCCTCCTAATCAATCCACGTCTAAAACCCCGC
JMSF037G24+ TTGACATCCGCCCATGCCCTCCAACTCGTCCTCCTAATCAATCCACGTCTAAAACCCCGC
                      ____________________________________________________________
consensus TTGACATCCGCCCATGCCCTCCAACTCGTCCTCCTAATCAATCCACGTCTAAAACCCCGC
 
. : . : . : . : . : . :
JMSF038G24+ CCCGGTAGAAACGGAGACCCGAATTCGAACAGAGTATGAGTGTGAGAGCGAGAGCTAAAA
JMSF037G24+ CCCGGTAGAAACGGAGACCCGAATTCGAACAGAGTATGAGTGTGAGAGCGAGAGCTAAAA
                      ____________________________________________________________
consensus CCCGGTAGAAACGGAGACCCGAATTCGAACAGAGTATGAGTGTGAGAGCGAGAGCTAAAA
 
. : . : . : . : . : . :
JMSF038G24+ CTTCTCTTGGGAAAGGTCGCCTCGGGTGAGCAGTGGAGNTTCGGAGGAAGGTTGTAGTAG
JMSF037G24+ CTTCTCTTGGGAAAGGTCGCCTCGGGTGAGCAGTGGAGCTTCGGAGGAAGGTTGTAGTAG
                      ____________________________________________________________
consensus CTTCTCTTGGGAAAGGTCGCCTCGGGTGAGCAGTGGAGCTTCGGAGGAAGGTTGTAGTAG
 
. : . : . : . : . : . :
JMSF038G24+ GAGAGAAGAAGAGCTCTCGCTGTCATAGCTNTGAGTGGCAGCGAGATTTCGCTGCTACTT
JMSF037G24+ GAGAGAAGAAGAGCTCTCGCTGTCATAGCTTTGAGTGGCAGCGAGATTTCGCTGCTACTT
                      ____________________________________________________________
consensus GAGAGAAGAAGAGCTCTCGCTGTCATAGCTTTGAGTGGCAGCGAGATTTCGCTGCTACTT
 
. : . : . : . : . : . :
JMSF038G24+ TCAATTCTGATTCTTTCTCTTCCTNTTCTCTTCGCCCAGTCTGTGTGTTCTGGTTGAGTC
JMSF037G24+ TCAATTCTGATTCTTTCTCTTCCTCTTCTCTTCGCCCAGTCTGTGTGTTCTGGTTGAGTC
                      ____________________________________________________________
consensus TCAATTCTGATTCTTTCTCTTCCTCTTCTCTTCGCCCAGTCTGTGTGTTCTGGTTGAGTC