Previous Contig 007152:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017D19Sequence568007152 (14)684007152 (14)gb:AF506825_18069021e-13Lycopersicon esculentum dehydration-responsive element binding protein 3 (DREB3)
JMFF025C10Sequence621007152 (14)638007152 (14)gb:AF506825_18069022e-09Lycopersicon esculentum dehydration-responsive element binding protein 3 (DREB3)
JMFF048F16Sequence462007152 (14)392007152 (14)
JMFF051H05Sequence644007152 (14)575007152 (14)gb:AF506825_18069027e-06Lycopersicon esculentum dehydration-responsive element binding protein 3 (DREB3)
JMFS058D07Sequence627007152 (14)gb:AF506825_18069024e-05Lycopersicon esculentum dehydration-responsive element binding protein 3 (DREB3)
JMFS117G09Sequence602007152 (14)
JMFS145E11Sequence621007152 (14)
JMFS159H06Sequence461007152 (14)gb:AF506825_18069021e-46Lycopersicon esculentum dehydration-responsive element binding protein 3 (DREB3)
JMSF037G20Sequence651007152 (14)650007152 (14)gb:AF506825_18069029e-16Lycopersicon esculentum dehydration-responsive element binding protein 3 (DREB3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF048F16- CTGGAGAGTT
                      ____________________________________________________________
consensus CTGGAGAGTT
 
. : . : . : . : . : . :
rJMFF048F16- TTTTTTTTTTTTTTAGCAAACTGAACAATTATTATAACACCGAAATTCAAAATAAAATAC
rJMFF051H05- AGCAAACTGAACAATTATTATAACACCGAAATTCAAAATAAAATAC
rJMSF037G20- AAATAC
rJMFF025C10- ATTATAACACCGAAATTCAAAATAAAATAC
rJMFF017D19- ATTATAACACCGAAATTCAAAATAAAATAC
                      ____________________________________________________________
consensus TTTTTTTTTTTTTTAGCAAACTGAACAATTATTATAACACCGAAATTCAAAATAAAATAC
 
. : . : . : . : . : . :
rJMFF048F16- AATATAGACACCAACATAAACACATTCTACCAAAAAAACATAAAATTCCCTGGTCTAGCC
rJMFF051H05- AATATAGACACCAACATAAACACATTCTACCAAAAAAACATAAAATTCCCTGGTCTAGCC
rJMSF037G20- AATATAGACACCAACATAAACACATTCTACCAAAAAAACATAAAATTCCCTGGTCTAGCC
rJMFF025C10- AATATAGACACCAACATAAACACATTCTACCAAAAAAACATAAAATTCCCTGGTCTAGCC
rJMFF017D19- AATATAGACACCAACATAAACACATTCTACCAAAAAAACATAAAATTCCCTGGTCTAGCC
                      ____________________________________________________________
consensus AATATAGACACCAACATAAACACATTCTACCAAAAAAACATAAAATTCCCTGGTCTAGCC
 
. : . : . : . : . : . :
rJMFF048F16- AAGACAAAAACCACTGGCTAGCCAGTTGAGGATCTTCCTAGTAATAACAATAACTACAAG
rJMFF051H05- AAGACAAAAACCACTGGCTAGCCAGTTGAGGATCTTCCTAGTAATAACAATAACTACAAG
rJMSF037G20- AAGACAAAAACCACTGGCTAGCCAGTTGAGGATCTTCCTAGTAATAACAATAACTACAAG
rJMFF025C10- AAGACAAAAACCACTGGCTAGCCAGTTGAGGATCTTCCTAGTAATAACAATAACTACAAG
rJMFF017D19- AAGACAAAAACCACTGGCTAGCCAGTTGAGGATCTTCCTAGTAATAACAATAACTACAAG
                      ____________________________________________________________
consensus AAGACAAAAACCACTGGCTAGCCAGTTGAGGATCTTCCTAGTAATAACAATAACTACAAG
 
. : . : . : . : . : . :
rJMFF048F16- GACTGACTCCATAATAATCAGCATGCTAAGGGCCTTCCCTGCAATTTTCAAAAATATCTT
rJMFF051H05- GACTGACTCCATAATAATCAGCATGCTAAGGGCCTTCCCTGCAATTTTCAAAAATATCTT
rJMSF037G20- GACTGACTCCATAATAATCAGCATGCTAAGGGCCTTCCCTGCAATTTTCAAAAATATCTT
rJMFF025C10- GACTGACTCCATAATAATCAGCATGCTAAGGGCCTTCCCTGCAATTTTCAAAAATATCTT
rJMFF017D19- GACTGACTCCATAATAATCAGCATGCTAAGGGCCTTCCCTGCAATTTTCAAAAATATCTT
                      ____________________________________________________________
consensus GACTGACTCCATAATAATCAGCATGCTAAGGGCCTTCCCTGCAATTTTCAAAAATATCTT
 
. : . : . : . : . : . :
rJMFF048F16- GCAGCCGGCCCCACCCTACACCATTCATCACGTGACCACATGTGACTTGGACCACTCCTT
rJMFF051H05- GCAGCCGGCCCCACCCTACACCATTCATCACGTGACCACATGTGACTTGGACCACTCCTT
rJMSF037G20- GCAGCCGGCCCCACCCTACACCATTCATCACGTGACCACATGTGACTTGGACCACTCCTT
rJMFF025C10- GCAGCCGGCCCCACCCTACACCATTCATCACGTGACCACATGTGACTTGGACCACTCCTT
rJMFF017D19- GCAGCCGGCCCCACCCTACACCATTCATCACGTGACCACATGTGACTTGGACCACTCCTT
                      ____________________________________________________________
consensus GCAGCCGGCCCCACCCTACACCATTCATCACGTGACCACATGTGACTTGGACCACTCCTT
 
. : . : . : . : . : . :
rJMFF048F16- TTTTTTCCTTAAAAATAAAAAGAAAAACTAATTAAAATAAAAGACTAATTATAGAGATGC
rJMFF051H05- TTTTTTCCTTAAAAATAAAAAGAAAAACTAATTAAAATAAAAGACTAATTATAGAGATGC
rJMSF037G20- TTTTTTCCTTAAAAATAAAAAGAAAAACTAATTAAAATAAAAGACTAATTATAGAGATGC
rJMFF025C10- TTTTTTCCTTAAAAATAAAAAGAAAAACTAATTAAAATAAAAGACTAATTATAGAGATGC
rJMFF017D19- TTTTTTCCTTAAAAATAAAAAGAAAAACTAATTAAAATAAAAGACTAATTATAGAGATGC
                      ____________________________________________________________
consensus TTTTTTCCTTAAAAATAAAAAGAAAAACTAATTAAAATAAAAGACTAATTATAGAGATGC
 
. : . : . : . : . : . :
rJMFF048F16- CCAATCAATCTCGTGAGATGGA
rJMFF051H05- CCAATCAATCTCGTGAGATGGATATTTTTGAAGCTCCGAGAACATGTCCCACGTGGACTC
rJMSF037G20- CCAATCAATCTCGTGAGATGGATATTTTTGAAGCTCCGAGAACATGTCCCACGTGGACTC
rJMFF025C10- CCAATCAATCTCGTGAGATGGATATTTTTGAAGCTCCGAGAACATGTCCCACGTGGACTC
rJMFF017D19- CCAATCAATCTCGTGAGATGGATATTTTTGAAGCTCCGAGAACATGTCCCACGTGGACTC
                      ____________________________________________________________
consensus CCAATCAATCTCGTGAGATGGATATTTTTGAAGCTCCGAGAACATGTCCCACGTGGACTC
 
. : . : . : . : . : . :
rJMFF051H05- TTCGTCCGTGAAATCCGGAAACGTTCGATCCGAAACGGGAGATGACCCGTCCGACCCGGA
rJMSF037G20- TTCGTCCGTGAAATCCGGAAACGTTCGATCCGAAACGGGAGATGACCCGTCCGACCCGGA
rJMFF025C10- TTCGTCCGTGAAATCCGGAAACGTTCGATCCGAAACGGGAGATGACCCGTCCGACCCGGA
rJMFF017D19- TTCGTCCGTGAAATCCGGAAACGTTCGATCCGAAACGGGAGATGACCCGTCCGACCCGGA
                      ____________________________________________________________
consensus TTCGTCCGTGAAATCCGGAAACGTTCGATCCGAAACGGGAGATGACCCGTCCGACCCGGA
 
. : . : . : . : . : . :
rJMFF051H05- ATCCGATCCGCAGATTTCGGGCACCGATCCGCTCGATCCAGAATCCGATCCGGAGTTTTC
rJMSF037G20- ATCCGATCCGCAGATTTCGGGCACCGATCCGCTCGATCCAGAATCCGATCCGGAGTTTTC
rJMFF025C10- ATCCGATCCGCAGATTTCGGGCACCGATCCGCTCGATCCAGAATCCGATCCGGAGTTTTC
rJMFF017D19- ATCCGATCCGCAGATTTCGGGCACCGATCCGCTCGATCCAGAATCCGATCCGGAGTTTTC
                      ____________________________________________________________
consensus ATCCGATCCGCAGATTTCGGGCACCGATCCGCTCGATCCAGAATCCGATCCGGAGTTTTC
 
. : . : . : . : . : . :
rJMFF051H05- GGGTCCCGCTTCGGCTGGCTTGTCATCCTCCACGGCTTCTTCCTTGGGC
rJMSF037G20- GGGTCCCGCTTCGGCTGGCTTGTCATCCTCCACGGCTTCTTCCTTGGGCTTTTGCGGCGG
rJMFF025C10- GGGTCCCGCTTCGGCTGGCTTGTCATCCTCCACGGCTTCTTCCTTGGGCTTTTGCGGCGG
rJMFF017D19- GGGTCCCGCTTCGGCTGGCTTGTCATCCTCCACGGCTTCTTCCTTGGGCTTTTGCGGCGG
                      ____________________________________________________________
consensus GGGTCCCGCTTCGGCTGGCTTGTCATCCTCCACGGCTTCTTCCTTGGGCTTTTGCGGCGG
 
. : . : . : . : . : . :
rJMSF037G20- AGCCGGCTTGGACTTCTTGGAGTCGAGGCTCTTGTTCTCGGCTAAGCTCTGGCAGATGGC
rJMFF025C10- AGCCGGCTTGGACTTCTTGGAGTCGAGGCTCTTGTTCTCGGCTAAGCTCTGGCAGATGGC
rJMFF017D19- AGCCGGCTTGGACTTCTTGGAGTCGAGGCTCTTGTTCTCGGCTAAGCTCTGGCAGATGGC
JMFS159H06+ AAGCTCTGGCAGATGGC
                      ____________________________________________________________
consensus AGCCGGCTTGGACTTCTTGGAGTCGAGGCTCTTGTTCTCGGCTAAGCTCTGGCAGATGGC
 
. : . : . : . : . : . :
rJMSF037G20- TTGCAGC-TTGGCGTCGACGTTGGAGTGGAGCGGCTTGTACTCGC
rJMFF025C10- TTGCAGCT
rJMFF017D19- TTGCAGCTTTGGCGTCNACGTTGGAGTGGAGCGGCTTGTACTCGCCGAAGTCGC
JMFS159H06+ TTGCAGC-TTGGCGTCGACGTTGGAGTGGAGCGGCTTGTACTCGCCGAAGTCGCCGCCGA
                      ____________________________________________________________
consensus TTGCAGC-TTGGCGTCGACGTTGGAGTGGAGCGGCTTGTACTCGCCGAAGTCGCCGCCGA
 
. : . : . : . : . : . :
JMFS159H06+ TGAGGGAGCCGTTGTGGCGCAGGTTAGGAAAGTTGAGCCGAGCCGAATCGCCTCGGAGCT
                      ____________________________________________________________
consensus TGAGGGAGCCGTTGTGGCGCAGGTTAGGAAAGTTGAGCCGAGCCGAATCGCCTCGGAGCT
 
. : . : . : . : . : . :
JMFS159H06+ TGTACGCCGCCTTGTCGTAGGCCAGCGCCGCCTCCTCCGCCGTGTCGAACGTCCCCAGCC
                      ____________________________________________________________
consensus TGTACGCCGCCTTGTCGTAGGCCAGCGCCGCCTCCTCCGCCGTGTCGAACGTCCCCAGCC
 
. : . : . : . : . : . :
JMFS159H06+ AGAGGCGGGTACGGTTCTTGGGCAAACGGATCTCCGCCACCCATTTCCCCCAGTGGCGCT
                      ____________________________________________________________
consensus AGAGGCGGGTACGGTTCTTGGGCAAACGGATCTCCGCCACCCATTTCCCCCAGTGGCGCT
 
. : . : . : . : . : . :
JMFS159H06+ GCCTCACCCCTCGGTACAGCTTGGCCGGCTTTGGCGGCGCGTGAGCCACCTTCATCGGCA
                      ____________________________________________________________
consensus GCCTCACCCCTCGGTACAGCTTGGCCGGCTTTGGCGGCGCGTGAGCCACCTTCATCGGCA
 
. : . : . : . : . : . :
JMFS159H06+ CCGGCCTCGGCGCCAAAAAGCTCAAATTCCGGCGCTGCTGCGGCGGCCACTGGCTCTGAA
                      ____________________________________________________________
consensus CCGGCCTCGGCGCCAAAAAGCTCAAATTCCGGCGCTGCTGCGGCGGCCACTGGCTCTGAA
 
. : . : . : . : . : . :
JMFS159H06+ ACGGCGCAGAGCCCATCATTTGTTGCGCCTGCAGATCGATTTGGGTCTGAATCTGCCGGA
JMFS058D07+ CAGAGCCCATCATNTGTTGCGCCTGCAGATCGATTTGGGTCTGAATCTGACGGA
                      ____________________________________________________________
consensus ACGGCGCAGAGCCCATCATTTGTTGCGCCTGCAGATCGATTTGGGTCTGAATCTGCCGGA
 
. : . : . : . : . : . :
JMFS159H06+ CTTGTAACGGCGTCAACGGGTTAAG
JMFS058D07+ CTTGTAACGGCGTCAACGGGTTAAGCCCGATAAAGCCCGACTGCCCAACCCCACAGCCCG
JMFF051H05+ ACGGGTTAAGCCCGATAAAGCCCGACTGCCCAACCCCACAGCCCG
JMFS145E11+ ACGGGTTAAGCCCGATAAAGCCCGACTGCCCAACCCCACAGCCCG
JMFS117G09+ TGCCCAACCCCACAGCCCG
JMFF025C10+ GACTGCCCAACCCCACAGCCCG
JMSF037G20+ ACGGGTTAAGCCCGATAAAGCCCGACTGCCCAACCCCACAGCCCG
                      ____________________________________________________________
consensus CTTGTAACGGCGTCAACGGGTTAAGCCCGATAAAGCCCGACTGCCCAACCCCACAGCCCG
 
. : . : . : . : . : . :
JMFS058D07+ AATAACCATTCTGAAACATGTGGGTTGTGGAGGTGGAGCAGCCATTAAAGCTCCCATAAG
JMFF051H05+ AATAACCATTCTGAAACATGTGGGTTGTGGAGGTGGAGCAGCCATTAAAGCTCCCATAAG
JMFS145E11+ AATAACCATTCTGAAACATGTGGGTTGTGGAGGTGGAGCAGCCATTAAAGCTCCCATAAG
JMFS117G09+ AATAACCATTCTGAAACATGTGGGTTGTGGAGGTGGAGCAGCCATTAAAGCTCCCATAAG
JMFF025C10+ AATAACCATTCTGAAACATGTGGGTTGTGGAGGTGGAGCAGCCATTAAAGCTCCCATAAG
JMFF017D19+ GGTGGAGCAGCCATTAAAGCTCCCATAAG
JMSF037G20+ AATAACCATTCTGAAACATGTGGGTTGTGGAGGTGGAGCAGCCATTAAAGCTCCCATAAG
                      ____________________________________________________________
consensus AATAACCATTCTGAAACATGTGGGTTGTGGAGGTGGAGCAGCCATTAAAGCTCCCATAAG
 
. : . : . : . : . : . :
JMFS058D07+ ATCCATAAAATAAATCAGAAGAAGAAGAAGGCGACGGAGACGGTGACGGAGAAGCACTGA
JMFF051H05+ ATCCATAAAATAAATCAGAAGAAGAAGAAGGCGACGGAGACGGTGACGGAGAAGCACTGA
JMFS145E11+ ATCCATAAAATAAATCAGAAGAAGAAGAAGGCGACGGAGACGGTGACGGAGAAGCACTGA
JMFS117G09+ ATCCATAAAATAAATCAGAAGAAGAAGAAGGCGACGGAGACGGTGACGGAGAAGCACTGA
JMFF025C10+ ATCCATAAAATAAATCAGAAGAAGAAGAAGGCGACGGAGACGGTGACGGAGAAGCACTGA
JMFF017D19+ ATCCATAAAATAAATCAGAAGAAGAAGAAGGCGACGGAGACGGTGACGGAGAAGCACTGA
JMSF037G20+ ATCCATAAAATAAATCAGAAGAAGAAGAAGGCGACGGAGACGGTGACGGAGAAGCACTGA
                      ____________________________________________________________
consensus ATCCATAAAATAAATCAGAAGAAGAAGAAGGCGACGGAGACGGTGACGGAGAAGCACTGA
 
. : . : . : . : . : . :
JMFS058D07+ TAAAAGGCTCAAGTGCTTCCATGAGATCCCCGCCGCCATTAAAAGGCTCTGAAGAATGAA
JMFF051H05+ TAAAAGGCTCAAGTGCTTCCATGAGATCCCCGCCGCCATTAAAAGGCTCTGAAGAATGAA
JMFS145E11+ TAAAAGGCTCAAGTGCTTCCATGAGATCCCCGCCGCCATTAAAAGGCTCTGAAGAATGAA
JMFS117G09+ TAAAAGGCTCAAGTGCTTCCATGAGATCCCCGCCGCCATTAAAAGGCTCTGAAGAATGAA
JMFF025C10+ TAAAAGGCTCAAGTGCTTCCATGAGATCCCCGCCGCCATTAAAAGGCTCTGAAGAATGAA
JMFF048F16+ TCCATGAGATCCCCGCCGCCATTAAAAGGCTTTGAAGAATGAA
JMFF017D19+ TAAAAGGCTCAAGTGCTTCCATGAGATCCCCGCCGCCATTAAAAGGCTCTGAAGAATGAA
JMSF037G20+ TAAAAGGCTCAAGTGCTTCCATGAGATCCCCGCCGCCATTAAAAGGCTCTGAAGAATGAA
                      ____________________________________________________________
consensus TAAAAGGCTCAAGTGCTTCCATGAGATCCCCGCCGCCATTAAAAGGCTCTGAAGAATGAA
 
. : . : . : . : . : . :
JMFS058D07+ AATCTACACCTATACTACTCCACAAATCCATGGTGGCAGCCATTAAAACAAGAAAATCAA
JMFF051H05+ AATCTACACCTATACTACTCCACAAATCCATGGTGGCAGCCATTAAAACAAGAAAATCAA
JMFS145E11+ AATCTACACCTATACTACTCCACAAATCCATGGTGGCAGCCATTAAAACAAGAAAATCAA
JMFS117G09+ AATCTACACCTATACTACTCCACAAATCCATGGTGGCAGCCATTAAAACAAGAAAATCAA
JMFF025C10+ AATCTACACCTATACTACTCCACAAATCCATGGTGGCAGCCATTAAAACAAGAAAATCAA
JMFF048F16+ AATCTACACCTATACTACTCCACAAATCCATGGTGGCAGCCATTAAAACAAGAAAATCAA
JMFF017D19+ AATCTACACCTATACTACTCCACAAATCCATGGTGGCAGCCATTAAAACAAGAAAATCAA
JMSF037G20+ AATCTACACCTATACTACTCCACAAATCCATGGTGGCAGCCATTAAAACAAGAAAATCAA
                      ____________________________________________________________
consensus AATCTACACCTATACTACTCCACAAATCCATGGTGGCAGCCATTAAAACAAGAAAATCAA
 
. : . : . : . : . : . :
JMFS058D07+ GAGGGTCTTCAAATAACAACCCCTTTTTGTTATAAAAATCAAACCTTTGAGGGACAACTA
JMFF051H05+ GAGGGTCTTCAAATAACAACCCCTTTTTGTTATAAAAATCAAACCTTTGAGGGACAACTA
JMFS145E11+ GAGGGTCTTCAAATAACAACCCCTTTTTGTTATAAAAATCAAACCTTTGAGGGACAACTA
JMFS117G09+ GAGGGTCTTCAAATAACAACCCCTTTTTGTTATAAAAATCAAACCTTTGAGGGACAACTA
JMFF025C10+ GAGGGTCTTCAAATAACAACCCCTTTTTGTTATAAAAATCAAACCTTTGAGGGACAACTA
JMFF048F16+ GAGGGTCTTCAAATAACAACCCCTTTTTGTTATAAAAATCAAACCTTTGAGGGACAACTA
JMFF017D19+ GAGGGTCTTCAAATAACAACCCCTTTTTGTTATAAAAATCAAACCTTTGAGGGACAACTA
JMSF037G20+ GAGGGTCTTCAAATAACAACCCCTTTTTGTTATAAAAATCAAACCTTTGAGGGACAACTA
                      ____________________________________________________________
consensus GAGGGTCTTCAAATAACAACCCCTTTTTGTTATAAAAATCAAACCTTTGAGGGACAACTA
 
. : . : . : . : . : . :
JMFS058D07+ ATAAGCCCTCGTGCAGATCAGATCAGATGAAGAAAAAACACAGAAAATAATTAAAAAAGA
JMFF051H05+ ATAAGCCCTCGTGCAGATCAGATCAGATGAAGAAAAAACACAGAAAATAATTAAAAAAGA
JMFS145E11+ ATAAGCCCTCGTGCAGATCAGATCAGATGAAGAAAAAACACAGAAAATAATTAAAAAAGA
JMFS117G09+ ATAAGCCCTCGTGCAGATCAGATCAGATGAAGAAAAAACACAGAAAATAATTAAAAAAGA
JMFF025C10+ ATAAGCCCTCGTGCAGATCAGATCAGATGAAGAAAAAACACAGAAAATAATTAAAAAAGA
JMFF048F16+ ATAAGCCCTCGTGCAGATCAGATCAGATGAAGAAAAAACACAGAAAATAATTAAAAAAGA
JMFF017D19+ ATAAGCCCTCGTGCAGATCAGATCAGATGAAGAAAAAACACAGAAAATAATTAAAAAAGA
JMSF037G20+ ATAAGCCCTCGTGCAGATCAGATCAGATGAAGAAAAAACACAGAAAATAATTAAAAAAGA
                      ____________________________________________________________
consensus ATAAGCCCTCGTGCAGATCAGATCAGATGAAGAAAAAACACAGAAAATAATTAAAAAAGA
 
. : . : . : . : . : . :
JMFS058D07+ AAACAGATCTCGATTCTGAAAACACCTGACTATTTTTCCAAAAACAGATTCTTGAAAAGC
JMFF051H05+ AAACAGATCTCGATTCTGAAAACACCTGACTATTTTTCCAAAAACAGATTCTTGAAAAGC
JMFS145E11+ AAACAGATCTCGATTCTGAAAACACCTGACTATTTTTCCAAAAACAGATTCTTGAAAAGC
JMFS117G09+ AAACAGATCTCGATTCTGAAAACACCTGACTATTTTTCCAAAAACAGATTCTTGAAAAGC
JMFF025C10+ AAACAGATCTCGATTCTGAAAACACCTGACTATTTTTCCAAAAACAGATTCTTGAAAAGC
JMFF048F16+ AAACAGATCTCGATTCTGAAAACACCTGACTATTTTTCCAAAAACAGATTCTTGAAAAGC
JMFF017D19+ AAACAGATCTCGATTCTGAAAACACCTGACTATTTTTCCAAAAACAGATTCTTGAAAAGC
JMSF037G20+ AAACAGATCTCGATTCTGAAAACACCTGACTATTTTTCCAAAAACAGATTCTTGAAAAGC
                      ____________________________________________________________
consensus AAACAGATCTCGATTCTGAAAACACCTGACTATTTTTCCAAAAACAGATTCTTGAAAAGC
 
. : . : . : . : . : . :
JMFS058D07+ AGATGATTTGCAGAAAGGGATCAAAGAAGCGGGGGATTCAGAGAGGGGGGGAAGAAATTT
JMFF051H05+ AGATGATTTGCAGAAAGGGATCAAAGAAGCGGGGGATTCAGAGAGGGGGGGAAGAAATTT
JMFS145E11+ AGATGATTTGCAGAAAGGGATCAAAGAAGCGGGGGATTCAGAGAGGGGGGGAAGAAATTT
JMFS117G09+ AGATGATTTGCAGAAAGGGATCAAAGAAGCGGGGGATTCAGAGAGGGGGGGAAGAAATTT
JMFF025C10+ AGATGATTTGCAGAAAGGGATCAAAGAAGCGGGGGATTCAGAGAGGGGGGGAAGAAATTT
JMFF048F16+ AGATGATTTGCAGAAAGGGATCAAAGAAGCGGGGGATTCAGAGAGGGGGGGAAGAAATTT
JMFF017D19+ AGATGATTTGCAGAAAGGGATCAAAGAAGCGGGGGATTCAGAGAGGGGGGGAAGAAATTT
JMSF037G20+ AGATGATTTGCAGAAAGGGATCAAAGAAGCGGGGGATTCAGAGAGGGGGGGAAGAAATTT
                      ____________________________________________________________
consensus AGATGATTTGCAGAAAGGGATCAAAGAAGCGGGGGATTCAGAGAGGGGGGGAAGAAATTT
 
. : . : . : . : . : . :
JMFS058D07+ TTACAGAAAAATCAGTGAAAATTTTCAAGAAAA
JMFF051H05+ TTACAGAAAAATCAGTGAAAATTTTCAAGAAAATCTTTTTGTTGTGTTAGTGAAGTGTGT
JMFS145E11+ TTACAGAAAAATCAGTGAAAATTTTCAAGAAAATCTTTTTGTTGTGTTAGTGAAGTGTGT
JMFS117G09+ TTACAGAAAAATCAGTGAAAATTTTCAAGAAAATCTTTTTGTTGTGTTAGTGAAGTGTGT
JMFF025C10+ TTACAGAAAAATCAGTGAAAATTTTCAAGAAAATCTTTTTGTTGTGTTAGTGAAGTGTGT
JMFF048F16+ TTACAGAAAAATCAGTGAAAATTTTCAAGAAAATCTTTTTGTTGTGTTAGTGAAGTGTGT
JMFF017D19+ TTACAGAAAAATCAGTGAAAATTTTCAAGAAAATCTTTTTGTTGTGTTAGTGAAGTGTGT
JMSF037G20+ TTACAGAAAAATCAGTGAAAATTTTCAAGAAAATCTTTTTGTTGTGTTAGTGAAGTGTGT
                      ____________________________________________________________
consensus TTACAGAAAAATCAGTGAAAATTTTCAAGAAAATCTTTTTGTTGTGTTAGTGAAGTGTGT
 
. : . : . : . : . : . :
JMFF051H05+ GCGAGTGTGAGGAAAAACCAACACACTGTATCTATATATCTCAGCCTCACCTTTTTTGT
JMFS145E11+ GCGAGTGTGAGGAAAAACCAACACACTGTATCT
JMFS117G09+ GCGAGTGTGAGGAAAAACCAACACACTGTATCTATATATCTCA
JMFF025C10+ GCGAGTGTGAGGAAAAACCAACACACTGTATCTATATATCTCAGCCTCACCTTTATTGT
JMFF048F16+ GCGAGTGTGAGGAAAAACCAACACACTGTATCTATATATCTCAGCCTCACCTTTTTTGT
JMFF017D19+ GCGAGTGTGAGGAAAAACCAACACACTGTATCTATATATCTCAGCCTCACCTTTTTTGT
JMSF037G20+ GCGAGTGTGAGGAAAAACCAACACACTGTATCTATATATCTCAGCCTCACCTTTTTTGTC
                      ____________________________________________________________
consensus GCGAGTGTGAGGAAAAACCAACACACTGTATCTATATATCTCAGCCTCACCTTTTTTGTC