Previous Contig 007141:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS121A03Sequence577007141 (3)gb:BT002043_16356461e-32Arabidopsis thaliana unknown protein (At2g12400) mRNA, complete cds.
JMSF015J18Sequence467007141 (3)gb:BT002043_16356463e-18Arabidopsis thaliana unknown protein (At2g12400) mRNA, complete cds.779013089 (2)gb:BT002043_16356466e-87Arabidopsis thaliana unknown protein (At2g12400) mRNA, complete cds.
JMSF037E01Sequence667007141 (3)gb:BT002043_16356464e-42Arabidopsis thaliana unknown protein (At2g12400) mRNA, complete cds.723013089 (2)gb:AK118866_18168214e-63Arabidopsis thaliana At2g25270 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037E01+ TCCAGCA
                      ____________________________________________________________
consensus TCCAGCA
 
. : . : . : . : . : . :
JMSF037E01+ GTGCTATTTGCCTGCTTTACTACATAGTCCAAAGTGTTTATCGTACTACTGTGAAATTTT
                      ____________________________________________________________
consensus GTGCTATTTGCCTGCTTTACTACATAGTCCAAAGTGTTTATCGTACTACTGTGAAATTTT
 
. : . : . : . : . : . :
JMFS121A03+ CCCTGCCCAAAGTATAGAATAACACATCCAACTATTGCAACTACGGTGAACAATACAAGG
JMSF037E01+ CCCTGCCCAAAGTATAGAATAACACATCCAACTATTGCAACTACGGTGAACAATACAAGG
                      ____________________________________________________________
consensus CCCTGCCCAAAGTATAGAATAACACATCCAACTATTGCAACTACGGTGAACAATACAAGG
 
. : . : . : . : . : . :
JMSF015J18+ TCGGCAGCAA
JMFS121A03+ AGAATAAGCGAAAGAGCATAAGCTATTCGAGAATATCCATAAGGTTCCCTTCGGCAGCAA
JMSF037E01+ AGAATAAGCGAAAGAGCATAAGCTATTCGAGAATATCCATAAGGTTCCCTTCGGCAGCAA
                      ____________________________________________________________
consensus AGAATAAGCGAAAGAGCATAAGCTATTCGAGAATATCCATAAGGTTCCCTTCGGCAGCAA
 
. : . : . : . : . : . :
JMSF015J18+ CAGAAGCAAAAGCAAATGAACAATAAGCATAGTCCAAAGATCGCGAACCAGATGAGAGCG
JMFS121A03+ CAGAAGCAAAAGCAAATGAACAATAAGCATAGTCCAAAGATCGCGAACCAGATGAGAGCG
JMSF037E01+ CAGAAGCAAAAGCAAATGAACAATAAGCATAGTCCAAAGATCGCGAACCAGATGAGAGCG
                      ____________________________________________________________
consensus CAGAAGCAAAAGCAAATGAACAATAAGCATAGTCCAAAGATCGCGAACCAGATGAGAGCG
 
. : . : . : . : . : . :
JMSF015J18+ ACTAAGAAGAACGGAACTGCAGTAAAAGCCACAGAACCCCAGTAATGGCGGTTGCTAATG
JMFS121A03+ ACTAAGAAGAACGGAACTGCAGTAAAAGCCACAGAACCCCAGTAATGGCGGTTGCTAATG
JMSF037E01+ ACTAAGAAGAACGGAACTGCAGTAAAAGCCACAGAACCCCAGTAATGGCGGTTGCTAATG
                      ____________________________________________________________
consensus ACTAAGAAGAACGGAACTGCAGTAAAAGCCACAGAACCCCAGTAATGGCGGTTGCTAATG
 
. : . : . : . : . : . :
JMSF015J18+ TTCCATCCACCTGTGTATCTCTTGAAATCATCGAGAGGGTCTTTCCTATATGTCCTCTTA
JMFS121A03+ TTCCATCCACCTGTGTATCTCTTGAAATCATCGAGAGGGTCTTTCCTATATGTCCTCTTA
JMSF037E01+ TTCCATCCACCTGTGTATCTCTTGAAATCATCGAGAGGGTCTTTCCTATATGTCCTCTTA
                      ____________________________________________________________
consensus TTCCATCCACCTGTGTATCTCTTGAAATCATCGAGAGGGTCTTTCCTATATGTCCTCTTA
 
. : . : . : . : . : . :
JMSF015J18+ GCAGCCAGGATGAGTGATGAGTTCAGTGGAGGCTCTTCTTCTTCAAGAACCCTTCTTCTC
JMFS121A03+ GCAGCCAGGATGAGTGATGAGTTCAGTGGAGGCTCTTCTTCTTCAAGAACCCTTCTTCTC
JMSF037E01+ GCAGCCAGGATGAGTGATGAGTTCAGTGGAGGCTCTTCTTCTTCAAGAACCCTTCTTCTC
                      ____________________________________________________________
consensus GCAGCCAGGATGAGTGATGAGTTCAGTGGAGGCTCTTCTTCTTCAAGAACCCTTCTTCTC
 
. : . : . : . : . : . :
JMSF015J18+ TCCCCAAAAATCACTTCATCAGTACTATAAATTTCCCCTTGAAAGTCCCCTGAAAGGGGA
JMFS121A03+ TCCCCAAAAATCACTTCATCAGTACTATAAATTTCCCCTTGAAAGTCCCCTGAAAGGGGA
JMSF037E01+ TCCCCAAAAATCACTTCATCAGTACTATAAATTTCCCCTTGAAAGTCCCCTGAAAGGGGA
                      ____________________________________________________________
consensus TCCCCAAAAATCACTTCATCAGTACTATAAATTTCCCCTTGAAAGTCCCCTGAAAGGGGA
 
. : . : . : . : . : . :
JMSF015J18+ AAGTGGGAAATGTGCTGATGTTTTGCTTTTTCTCCTCCTCCAAAACAGACAAAGGTAGAG
JMFS121A03+ AAGTGGGAAATGTGCTGATGTTTTGCTTTTTCTCCTCCTCCAAAACAGACAAAGGTAGAG
JMSF037E01+ AAGTGGGAAATGTGCTGATGTTTTGCTTTTTCTCCTCCTCCAAAACAGACAAAGGTAGAG
                      ____________________________________________________________
consensus AAGTGGGAAATGTGCTGATGTTTTGCTTTTTCTCCTCCTCCAAAACAGACAAAGGTAGAG
 
. : . : . : . : . : . :
JMSF015J18+ GAAGAGAAAAGCAAGGAAATAGTTAGAAGAGAAAAGAGGAGTGACCCTTTGCACAGCATT
JMFS121A03+ GAAGAGAAAAGCAAGGAAATAGTTAGAAGAGAAAAGAGGAGTGACCCTTTGCACAGCATT
JMSF037E01+ GAAGAGAAAAGCAAGGAAATAGTTAGAAGAGAAAAGAGGAGTGACCCTTTGCACAGCATT
                      ____________________________________________________________
consensus GAAGAGAAAAGCAAGGAAATAGTTAGAAGAGAAAAGAGGAGTGACCCTTTGCACAGCATT
 
. : . : . : . : . : . :
JMSF015J18+ GTGTTTGTACCAGCTACTATGGCTGGAAATCTCCTT
JMFS121A03+ GTGTTTGTACCAGCTACTATGGCTGGAAATCTCCTT
JMSF037E01+ GTGTTTGTACCAGCTACTATGGCTGGAAATCTCCTTGGAAGCACTGGAGAGGGAAAGTCC
                      ____________________________________________________________
consensus GTGTTTGTACCAGCTACTATGGCTGGAAATCTCCTTGGAAGCACTGGAGAGGGAAAGTCC