Previous Contig 007139:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF010I09Sequence438007139 (4)pir|T05942|T059422e-33cytochrome P450 82C1 - soybean>gb:AF022461_1761996 Glycine max cytochrome P450 m743012014 (4)pir|T05942|T059421e-88cytochrome P450 82C1 - soybean>gb:AF022461_1761996 Glycine max cytochrome P450 m
JMSF018G15Sequence503007139 (4)pir|T05942|T059426e-39cytochrome P450 82C1 - soybean>gb:AF022461_1761996 Glycine max cytochrome P450 m782012014 (4)pir|T05942|T059425e-82cytochrome P450 82C1 - soybean>gb:AF022461_1761996 Glycine max cytochrome P450 m
JMSF034I15Sequence663007139 (4)pir|T05942|T059422e-64cytochrome P450 82C1 - soybean>gb:AF022461_1761996 Glycine max cytochrome P450 m730012014 (4)pir|T05942|T059426e-79cytochrome P450 82C1 - soybean>gb:AF022461_1761996 Glycine max cytochrome P450 m
JMSF037D11Sequence645007139 (4)pir|T05942|T059422e-51cytochrome P450 82C1 - soybean>gb:AF022461_1761996 Glycine max cytochrome P450 m760012014 (4)pir|T05942|T059423e-78cytochrome P450 82C1 - soybean>gb:AF022461_1761996 Glycine max cytochrome P450 m

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034I15+ AGCTCTTTCGCAATTCTCTT
                      ____________________________________________________________
consensus AGCTCTTTCGCAATTCTCTT
 
. : . : . : . : . : . :
JMSF034I15+ CATCGACTTCTTGTGCCCTTGCAAGTCCAGCCAGTCAAGGAAGGGGAAAGAATCAGACAA
                      ____________________________________________________________
consensus CATCGACTTCTTGTGCCCTTGCAAGTCCAGCCAGTCAAGGAAGGGGAAAGAATCAGACAA
 
. : . : . : . : . : . :
JMSF034I15+ CACAAACACACCAAAGAAGTACAGGAATCCTCTGATCACTTTTTCGCACCTTCTCGCCTC
                      ____________________________________________________________
consensus CACAAACACACCAAAGAAGTACAGGAATCCTCTGATCACTTTTTCGCACCTTCTCGCCTC
 
. : . : . : . : . : . :
JMSF034I15+ TTCCTTGTTGCAATCCACGCCGTCTCCGGTGAACCTCTTCCCTCCGACCATCCTCACTGA
                      ____________________________________________________________
consensus TTCCTTGTTGCAATCCACGCCGTCTCCGGTGAACCTCTTCCCTCCGACCATCCTCACTGA
 
. : . : . : . : . : . :
JMSF034I15+ CATGTTCCGGATCAGGTTTACAAACCACGGCTGCAAATCCACCATGACACCACGGTTAGG
JMSF037D11+ ATGAAACCACGCTCAGG
                      ____________________________________________________________
consensus CATGTTCCGGATCAGGTTTACAAACCACGGCTGCAAATCCACCATGACACCACGGTTAGG
 
. : . : . : . : . : . :
JMSF034I15+ ATTTCCACTGCTAACCCATAACTCATACAGCTCTCTGATGGAAGTCTCCAGTTCTGATGC
JMSF018G15+ TCTGATGC
JMSF037D11+ ATTTCCATTGCTAACCCACAACTCATACAGCTCTCTAATGGAAGTCTCCAGTTCTGATGT
                      ____________________________________________________________
consensus ATTTCCATTGCTAACCCATAACTCATACAGCTCTCTGATGGAAGTCTCCAGTTCTGATGC
 
. : . : . : . : . : . :
JMSF034I15+ TCTTATCGGGTTCAGCATATCAACCTGCCGGTTAGACAGGAGATGGAGAGTGGAAATCTT
JMSF010I09+ CTT
JMSF018G15+ TCTTATCGGCTTCAGCATATCAACCTGCCGGTTAGACAGGAGATGGAGAGTGGAAATCTT
JMSF037D11+ TCTTATGGGATTCAGCATCTCAACTTGCCGGTTAGAGAGAAGATGGAGAGTGACAATCTT
                      ____________________________________________________________
consensus TCTTATCGGGTTCAGCATATCAACCTGCCGGTTAGACAGGAGATGGAGAGTGGAAATCTT
 
. : . : . : . : . : . :
JMSF034I15+ GCGCACCTCTCGCCAATATTCCCCGTAAGGAGAAAGCCCGAAGAAAGCATAATCATAGCC
JMSF010I09+ GCGCACCTCTCGCCAATATTCCCCGTAAGGAGAAAGCCCGAAGAAAGCATAATCATAGCC
JMSF018G15+ GCGCACCTCTCGCCAATATTCCCCGTAAGGAGAAAGCCCGAAGAAAGCATAATCATAGCC
JMSF037D11+ GCGCATTTCTCGCCAATATTCCCCGTAAGGAGCGACGCCGAAGAAAGCATAATCATAGCC
                      ____________________________________________________________
consensus GCGCACCTCTCGCCAATATTCCCCGTAAGGAGAAAGCCCGAAGAAAGCATAATCATAGCC
 
. : . : . : . : . : . :
JMSF034I15+ AAGAAGCTTAGAAGCAGCTAGTCTCGGACGGTCACTGAATACCTTGTCGTGAGTGGTGAA
JMSF010I09+ AAGAAGCTTAGAAGCAGCTAGTCTCGGACGGTCACTGAATACCTTGTCGTGAGTGGTGAA
JMSF018G15+ AAGAAGCTTAGAAGCAGCTAGTCTCGGACGGTCACTGAATACCTTGTCGTGAGTGGTGAA
JMSF037D11+ GAGAAACTTAGAGGCGGCTATTCTCGGACGGTCGCAGAATGCCTTGTCGTGAGTGGTGTA
                      ____________________________________________________________
consensus AAGAAGCTTAGAAGCAGCTAGTCTCGGACGGTCACTGAATACCTTGTCGTGAGTGGTGAA
 
. : . : . : . : . : . :
JMSF034I15+ ACACTCCCTTGCCATTTCCCAACTACTTATGACCAAAGCTTGATGACTGCCCAGCTTTAT
JMSF010I09+ ACACTCCCTTGCCATTTCCCAACTACTTATGACCAAAGCTTGATGACTGCCCAGCTTTAT
JMSF018G15+ ACACTCCCTTGCCATTTCCCAACTACTTATGACCAAAGCTTGATGACTGCCCAGCTTTAT
JMSF037D11+ ACACTCCCTCGCCATTTCCCAACTACTTATGACCAGAGCTTTATGGCTGCCGAGCTTTAT
                      ____________________________________________________________
consensus ACACTCCCTTGCCATTTCCCAACTACTTATGACCAAAGCTTGATGACTGCCCAGCTTTAT
 
. : . : . : . : . : . :
JMSF034I15+ CCCCATCGCCGGTCCATACTTGTCGGCCATGGCACTGAGTACTTTATAAATAAGTTTGCC
JMSF010I09+ CCCCATCGCCGGTCCATACTTGTCGGCCATGGCACTGAGTACTTTATAAATAAGTTTGCC
JMSF018G15+ CCCCATCGCCGGTCCATACTTGTCGGCCATGGCACTGAGTACTTTATAAATAAGTTTGCC
JMSF037D11+ CGCCATCGCCGGTCCATGCTTGTCGGCCATGGCGCCGAGGACTTTATACGTAAGTTTGCC
                      ____________________________________________________________
consensus CCCCATCGCCGGTCCATACTTGTCGGCCATGGCACTGAGTACTTTATAAATAAGTTTGCC
 
. : . : . : . : . : . :
JMSF034I15+ ACCGCTGAAGCAAAGCAGGTGGCCAATAACAGGCAAAGCGC
JMSF010I09+ ACCGCTGAAGCAAAGCAGGTGGCCAATAACAGGCAAAGCGCCATCAGGCTGTGGCAAACT
JMSF018G15+ ACCGCTGAAGCAAAGCAGGTGGCCAATAACAGGCAAAGCGCCATCAGGCTGTGGCAAACT
JMSF037D11+ ACCGCCGAAGCAGAAAAGGTGGCCGATAACCGGCAAAGCGCCGTCCGGTTGCGGCAAACT
                      ____________________________________________________________
consensus ACCGCTGAAGCAAAGCAGGTGGCCAATAACAGGCAAAGCGCCATCAGGCTGTGGCAAACT
 
. : . : . : . : . : . :
JMSF010I09+ CCGGCCCTTAATTTCAGCAACTTGTCT---CCTTGACTGAAAGTAACGAACCAAGAAAAT
JMSF018G15+ CCGGCCCTTAATTTCAGCAACTTGTCT---CCTTGACTGAAAGTAACGAACCAAGAAAAT
JMSF037D11+ CCGGCCTTTTATGTCAGAAACCCGTCTCCGCCTTGACTGAAAGTAACGAGCCAAGAAAAT
                      ____________________________________________________________
consensus CCGGCCCTTAATTTCAGCAACTTGTCT---CCTTGACTGAAAGTAACGAACCAAGAAAAT
 
. : . : . : . : . : . :
JMSF010I09+ CAAGGCACAGAGAGTTGATGCAAAAGTTAGAAGAAGTTGGAATCTTTGATCCAT
JMSF018G15+ CAAGGCACAGAGAGTTGATGCAAAAGTTAGAAGAAGTTGGAATCTTTGATCCAT
JMSF037D11+ CAAGGCGCAGAGAGTTGATACAAAAGTTAGAAGAAGTTGGAATCTTTGATCCATGGATGT
                      ____________________________________________________________
consensus CAAGGCACAGAGAGTTGATGCAAAAGTTAGAAGAAGTTGGAATCTTTGATCCATGGATGT
 
. : . : . : . : . : . :
JMSF037D11+ TTGTGATATGGAAGAGGCGTCAGACATGGCGGTTCAGAATGTCTCTGCTAAGCAACTGTC
                      ____________________________________________________________
consensus TTGTGATATGGAAGAGGCGTCAGACATGGCGGTTCAGAATGTCTCTGCTAAGCAACTGTC