Previous Contig 007136:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF037D02Sequence667007136 (2)gb:AY663785_16205885e-60Fragaria x ananassa UDP-glucose glucosyltransferase (sgt2) mRNA, complete cds.690013086 (2)gb:AY171598_15867412e-58Fragaria x ananassa UDP-glucosyl transferase mRNA, complete cds.
JMSF047L02Sequence675007136 (2)gb:AY663785_16205883e-56Fragaria x ananassa UDP-glucose glucosyltransferase (sgt2) mRNA, complete cds.694013086 (2)gb:AY171598_15867412e-58Fragaria x ananassa UDP-glucosyl transferase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF047L02+ CCAGAAATGGAAAGGGACTG
JMSF037D02+ GGGACTG
                      ____________________________________________________________
consensus CCAGAAATGGAAAGGGACTG
 
. : . : . : . : . : . :
JMSF047L02+ GAAGGGTGCAAGAAACTCGGGATTTCATCGTACTTCAACAATGGCATGCACGGCAACTGA
JMSF037D02+ GAAGGGTGCAAGAAACTCGGGATTTCATCGTACTTCAACAATGGCATGCACGGCAACTGA
                      ____________________________________________________________
consensus GAAGGGTGCAAGAAACTCGGGATTTCATCGTACTTCAACAATGGCATGCACGGCAACTGA
 
. : . : . : . : . : . :
JMSF047L02+ ACATCACTTTCCGGCTCCGATTCCGACGGGAACGGAACTGATTTATTATAGTAATGGTAA
JMSF037D02+ ACATCACTTTCCGGCTCCGATTCCGACGGGAACGGAACTGATTTATTATAGTAATGGTAA
                      ____________________________________________________________
consensus ACATCACTTTCCGGCTCCGATTCCGACGGGAACGGAACTGATTTATTATAGTAATGGTAA
 
. : . : . : . : . : . :
JMSF047L02+ TAGCAAGAAAAGGAAGCGCAAGATTGAACCCAAAGCACGGCGTTTGGAATCCCCAGGCTC
JMSF037D02+ TAGCAAGAAAAGGAAGCGCAAGATTGAACCCAAAGCACGGCGTTTGGAATCCCCAGGCTC
                      ____________________________________________________________
consensus TAGCAAGAAAAGGAAGCGCAAGATTGAACCCAAAGCACGGCGTTTGGAATCCCCAGGCTC
 
. : . : . : . : . : . :
JMSF047L02+ TCCGCCACGTCGGAAACCCAAGGAATGAACGGATTATGGATCAAACAGCAAACCGGCCGG
JMSF037D02+ TCCGCCACGTCGGAAACCCAAGGAATGAACGGATTATGGATCAAACAGCAAACCGGCCGG
                      ____________________________________________________________
consensus TCCGCCACGTCGGAAACCCAAGGAATGAACGGATTATGGATCAAACAGCAAACCGGCCGG
 
. : . : . : . : . : . :
JMSF047L02+ CCTTGCTTTTCATATTCCTTCACCATCTCCGCCACTTTCCGGGAGCCAACCAGCTGGAGA
JMSF037D02+ CCTTGCTTTTCATATTCCTTCACCATCTCCGCCACTTTCCGGGAGCCAACCAGCTGGAGA
                      ____________________________________________________________
consensus CCTTGCTTTTCATATTCCTTCACCATCTCCGCCACTTTCCGGGAGCCAACCAGCTGGAGA
 
. : . : . : . : . : . :
JMSF047L02+ TGATCGATGTAAAAGTCGACGTCGTCGCCGTTCTCGGAGTGCGGGAACTCGTCGTCGAAG
JMSF037D02+ TGATCGATGTAAAAGTCGACGTCGTCGCCGTTCTCGGAGTGCGGGAACTCGTCGTCGAAG
                      ____________________________________________________________
consensus TGATCGATGTAAAAGTCGACGTCGTCGCCGTTCTCGGAGTGCGGGAACTCGTCGTCGAAG
 
. : . : . : . : . : . :
JMSF047L02+ AACTCGAACCTTATCATGCCGTCGCCGTACGGCGTGGGTTCGCCGGAGATGTTGCTGTTG
JMSF037D02+ AACTCGAACCTTATCATGCAGTCGCCGTACGGCGTGGGTTCGCCGGAGATGTTGCTGTTG
                      ____________________________________________________________
consensus AACTCGAACCTTATCATGCCGTCGCCGTACGGCGTGGGTTCGCCGGAGATGTTGCTGTTG
 
. : . : . : . : . : . :
JMSF047L02+ GCTTTTCTCATGTCTCTCCCCACCGTTTCCGGCGCCGAGAAGGTGACGAGGAGGCCCTTG
JMSF037D02+ GCTTTTCTCATGTCTCTCCCCACCGTTTCCGGCGCCGAGAAGGTGACGAGGAGGCCCTTG
                      ____________________________________________________________
consensus GCTTTTCTCATGTCTCTCCCCACCGTTTCCGGCGCCGAGAAGGTGACGAGGAGGCCCTTG
 
. : . : . : . : . : . :
JMSF047L02+ CTGGCCAGCCGCTTTCCCAGCCTGAGCAGCGGGTTCACGTGGCCCTGCCCGGGAAACGAG
JMSF037D02+ CTGGCCAGCCGCTTTCCCAGCCTGAGCAGCGGGTTCACGTGGCCCTGCCCGGGAAACGAG
                      ____________________________________________________________
consensus CTGGCCAGCCGCTTTCCCAGCCTGAGCAGCGGGTTCACGTGGCCCTGCCCGGGAAACGAG
 
. : . : . : . : . : . :
JMSF047L02+ ATGAGTAAGGCGTGAGGGAGAGACGGTCCGGCGATTTCTTTAGAGCCCATTTTCGTCGAC
JMSF037D02+ ATGAGTAAGGCGTGAGGGAGAGACGGTCCGGCGATTTCTTTAGAGCCCATTTTCGTCGAC
                      ____________________________________________________________
consensus ATGAGTAAGGCGTGAGGGAGAGACGGTCCGGCGATTTCTTTAGAGCCCATTTTCGTCGAC
 
. : . : . : . : . : . :
JMSF047L02+ GACGGGGAATGCGGCGGCTTATGGCGACGGACGGAGCTCTTGAGGGGTGGTAG
JMSF037D02+ GACGGGGAATGCGGCGGCTTATGGCGACGGACGGAGCTCTTGAGGGGTGGTAGTGGACCC
                      ____________________________________________________________
consensus GACGGGGAATGCGGCGGCTTATGGCGACGGACGGAGCTCTTGAGGGGTGGTAGTGGACCC