Previous Contig 007130:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016C02Sequence583007130 (4)gb:AP004048_18369103e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12800013079 (4)gb:ATAC015985_15435776e-82Arabidopsis thaliana chromosome III BAC F8A24 genomic sequence, complete sequenc
JMFF050I14Sequence617007130 (4)gb:AP004048_18369102e-36Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12582013079 (4)gb:AF131222_17708371e-31Lophopyrum elongatum protein serine/threonine kinase (ESI47) mRNA, complete cds.
JMSF017J16Sequence491007130 (4)gb:AP004048_18369104e-31Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12772013079 (4)gb:ATAC015985_15435772e-67Arabidopsis thaliana chromosome III BAC F8A24 genomic sequence, complete sequenc
JMSF037B10Sequence623007130 (4)gb:AP004048_18369107e-31Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12763013079 (4)gb:ATAC015985_15435775e-46Arabidopsis thaliana chromosome III BAC F8A24 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF017J16+ GTCCCTGCAGTCCTCTT
JMFF050I14+ GCCAAGGACATTCACTTCTGTGACCCATTCTCTGTGTCCCTGCAGTCCTCTT
JMFF016C02+ GTCCCTGCAGTCCTCTT
JMSF037B10+ GTCCCTGCAGTCCTCTT
                      ____________________________________________________________
consensus GCCAAGGACATTCACTTCTGTGACCCATTCTCTGTGTCCCTGCAGTCCTCTT
 
. : . : . : . : . : . :
JMSF017J16+ CTACTAAGTTGTTTTACAGCCACATCAACTCTACTAGCTGGATCTTCAGAATTCTTGATT
JMFF050I14+ CTACTAAGTTGTTTTACAGCCACATCAACTCTACTAGCTGGATCTTCAGAATTCTTGATT
JMFF016C02+ CTACTAAGTTGTTTTACAGCCACATCAACTCTACTAGCTGGATCTTCAGAATTCTTGATT
JMSF037B10+ CTACTAAGTTGTTTTACAGCCACATCAACTCTACTAGCTGGATCTTCAGAATTCTTGATT
                      ____________________________________________________________
consensus CTACTAAGTTGTTTTACAGCCACATCAACTCTACTAGCTGGATCTTCAGAATTCTTGATT
 
. : . : . : . : . : . :
JMSF017J16+ GTTGCCTTATACACTGGCCCAAATCCT-CCCTCCCCAATCTTGGTTGAACGGTTAAAATT
JMFF050I14+ GTTGCCTTATACACTGGCCCAAATCCT-CCCTCCCCAATCTTGGTTGAACGGTTAAAATT
JMFF016C02+ GTTGCCTTATACACTGGCCCAAATCCTCCCCTCCCCAATCTTGGTTGAACGGTTAAAATT
JMSF037B10+ GTTGCCTTATACACTGGCCCAAATCCT-CCCTCCCCAATCTTGGTTGAACGGTTAAAATT
                      ____________________________________________________________
consensus GTTGCCTTATACACTGGCCCAAATCCT-CCCTCCCCAATCTTGGTTGAACGGTTAAAATT
 
. : . : . : . : . : . :
JMSF017J16+ TTTCGTTGCTGATTTCAATTCTGAGAATGAAAAGTCCCTTAGATTGGATGGCCTCTCACT
JMFF050I14+ TTTCGTTGCTGATTTCAATTCTGAGAATGAAAAGTCCCTTAGATTGGATGGCCTCTCACT
JMFF016C02+ TTTCGTTGCTGATTTCAATTCTGAGAATGAAAAGTCCCTTAGATTGGATGGCCTCTCACT
JMSF037B10+ TTTCGTTGCTGATTTCAATTCTGAGAATGAAAAGTCCCTTAGATTGGATGGCCTCTCACT
                      ____________________________________________________________
consensus TTTCGTTGCTGATTTCAATTCTGAGAATGAAAAGTCCCTTAGATTGGATGGCCTCTCACT
 
. : . : . : . : . : . :
JMSF017J16+ CATACTTGGAAATTGAGTCCTTCCCCTGGACTCTGTACTAGTATCTGATGCATTCTGAGA
JMFF050I14+ CATACTTGGAAATTGAGTCCTTCCCCTGGACTCTGTACTAGTATCTGATGCATTCTGAGA
JMFF016C02+ CATACTTGGAAATTGAGTCCTTCCCCTGGACTCTGTACTAGTATCTGATGCATTCTGAGA
JMSF037B10+ CATACTTGGAAATTGAGTCCTTCCCCTGGACTCTGTACTAGTATCTGATGCATTCTGAGA
                      ____________________________________________________________
consensus CATACTTGGAAATTGAGTCCTTCCCCTGGACTCTGTACTAGTATCTGATGCATTCTGAGA
 
. : . : . : . : . : . :
JMSF017J16+ GCTGGATTCAAGATTAGAGTGCTTCACATCATGATCAGAAAAGCCAGAACAGGATGAGAG
JMFF050I14+ GCTGGATTCAAGATTAGAGTGCTTCACATCATGATCAGAAAAGCCAGAACAGGATGAGAG
JMFF016C02+ GCTGGATTCAAGATTAGAGTGCTTCACATCATGATCAGAAAAGCCAGAACAGGATGAGAG
JMSF037B10+ GCTGGATTCAAGATTAGAGTGCTTCACATCATGATCAGAAAAGCCAGAACAGGATGAGAG
                      ____________________________________________________________
consensus GCTGGATTCAAGATTAGAGTGCTTCACATCATGATCAGAAAAGCCAGAACAGGATGAGAG
 
. : . : . : . : . : . :
JMSF017J16+ GACCGGAGTTGACTTCACTATCTTTGGTTCTTCATCCTTTTCATCATTGTGGAATAGAAA
JMFF050I14+ GACCGGAGTTGACTTCACTATCTTTGGTTCTTCATCCTTTTCATCATTGTGGAATAGAAA
JMFF016C02+ GACCGGAGTTGACTTCACTATCTTTGGTTCTTCATCCTTTTCATCATTGTGGAATAGAAA
JMSF037B10+ GACCGGAGTTGACTTCACTATCTTTGGTTCTTCATCCTTTTCATCATTGTGGAATAGAAA
                      ____________________________________________________________
consensus GACCGGAGTTGACTTCACTATCTTTGGTTCTTCATCCTTTTCATCATTGTGGAATAGAAA
 
. : . : . : . : . : . :
JMSF017J16+ ACACCTCATGGTCATCAATAAATCAGGGTACCGTCAATACAGATTCTTTGTGCTTGAGAG
JMFF050I14+ ACACCTCATGGTCATCAATAAATCAGGGTACCGTCAATACAGATTCTTTGTGCTTGAGAG
JMFF016C02+ ACACCTCATGGTCATCAATAAATCAGGGTACCGTCAATACAGATTCTTTGTGCTTGAGAG
JMSF037B10+ ACACCTCATGGTCATCAATAAATCAGGGTACCGTCAATACAGATTCTTTGTGCTTGAGAG
                      ____________________________________________________________
consensus ACACCTCATGGTCATCAATAAATCAGGGTACCGTCAATACAGATTCTTTGTGCTTGAGAG
 
. : . : . : . : . : . :
JMSF017J16+ CTGAATGCAAGGAAGGATTGACTTCTGGCAAGCTGGACTCACCAAGT
JMFF050I14+ CTGAATGCAAGGAAGGATTGACTTCTGGCAAGCTGGACTCACCAAGTATCAAATAAAGGT
JMFF016C02+ CTGAATGCAAGGAAGGATTGACTTCTGGCAAGCTGGACTCACCAAGTATCAAATAAAGGT
JMSF037B10+ CTGAATGCAAGGAAGGATTGACTTCTGGCAAGCTGGACTCACCAAGTATCAAATAAAGGT
                      ____________________________________________________________
consensus CTGAATGCAAGGAAGGATTGACTTCTGGCAAGCTGGACTCACCAAGTATCAAATAAAGGT
 
. : . : . : . : . : . :
JMFF050I14+ TCAGTCTTTGATCATTTATGAGAAAACTCAGTGCCCAAAGTAGCCTCCTCAGCTGCAAGT
JMFF016C02+ TCAGTCTTTGATCATTTATGAGAAAACTCAGTGCCCAAAGTAGCCTCCTCAGCTGCAAGT
JMSF037B10+ TCAGTCTTTGATCATTTATGAGAAAACTCAGTGCCCAAAGTAGCCTCCTCAGCTGCAAGT
                      ____________________________________________________________
consensus TCAGTCTTTGATCATTTATGAGAAAACTCAGTGCCCAAAGTAGCCTCCTCAGCTGCAAGT
 
. : . : . : . : . : . :
JMFF050I14+ CAAGAACAAAGACTTGGT
JMFF016C02+ CAAGAACAAAGACTTGGT
JMSF037B10+ CAAGAACAAAGACTTGGTTGGCCAACACAGAGAAAAACGTCTACACACGGCAGCACGACA
                      ____________________________________________________________
consensus CAAGAACAAAGACTTGGTTGGCCAACACAGAGAAAAACGTCTACACACGGCAGCACGACA