Previous Contig 007126:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001H14Sequence532007126 (7)gb:AC092781_17357412e-30Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.483007126 (7)gb:AC092781_17357412e-30Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.
JMFF037N15Sequence532007126 (7)gb:AC092781_17357412e-30Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.502007126 (7)gb:AC092781_17357412e-30Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.
JMFN034N05Sequence526007126 (7)gb:AC092781_17357412e-30Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.
JMSF036P24Sequence573007126 (7)gb:AC092781_17357413e-30Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.530007126 (7)gb:AC092781_17357412e-30Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF037N15+ TTATCATTGAAGC
JMFF001H14+ TTATCATTGAAGC
JMFN034N05+ ATCATTGAAGC
JMSF036P24+ TAAGCCAAATGAAATCAAAATTATCATTGAAGC
                      ____________________________________________________________
consensus TAAGCCAAATGAAATCAAAATTATCATTGAAGC
 
. : . : . : . : . : . :
rJMSF036P24- AATTGCATTCCCAACCTCAAAATGAGGCAATAGGTTCTTGATTCAGGGTC
JMFF037N15+ ATATATATGAAATTGCATTCCCAACCTCAAAATGAGGCAATAGGTTCTTGATTCAGGGTC
rJMFF037N15- AAATTGCATTCCCAACCTCAAAATGAGGCAATAGGTTCTTGATTCAGGGTC
JMFF001H14+ ATATATATGAAATTGCATTCCCAACCTCAAAATGAGGCAATAGGTTCTTGATTCAGGGTC
JMFN034N05+ ATATATATGAAATTGCATTCCCAACCTCAAAATGAGGCAATAGGTTCTTGATTCAGGGTC
rJMFF001H14- AAATGAGGCAATAGGTTCTTGATTCAGGGTC
JMSF036P24+ ATATATATGAAATTGCATTCCCAACCTCAAAATGAGGCAATAGGTTCTTGATTCAGGGTC
                      ____________________________________________________________
consensus ATATATATGAAATTGCATTCCCAACCTCAAAATGAGGCAATAGGTTCTTGATTCAGGGTC
 
. : . : . : . : . : . :
rJMSF036P24- GAAGTGCAAAAGAGATTCAATGAAATCATGAAAGTAGATCTGAAGCCTCAGCATAGATGA
JMFF037N15+ GAAGTGCAAAAGAGATTCAATGAAATCATGAAAGTAGATCTGAAGCCTCAGCATAGATGA
rJMFF037N15- GAAGTGCAAAAGAGATTCAATGAAATCATGAAAGTAGATCTGAAGCCTCAGCATAGATGA
JMFF001H14+ GAAGTGCAAAAGAGATTCAATGAAATCATGAAAGTAGATCTGAAGCCTCAGCATAGATGA
JMFN034N05+ GAAGTGCAAAAGAGATTCAATGAAATCATGAAAGTAGATCTGAAGCCTCAGCATAGATGA
rJMFF001H14- GAAGTGCAAAAGAGATTCAATGAAATCATGAAAGTAGATCTGAAGCCTCAGCATAGATGA
JMSF036P24+ GAAGTGCAAAAGAGATTCAATGAAATCATGAAAGTAGATCTGAAGCCTCAGCATAGATGA
                      ____________________________________________________________
consensus GAAGTGCAAAAGAGATTCAATGAAATCATGAAAGTAGATCTGAAGCCTCAGCATAGATGA
 
. : . : . : . : . : . :
rJMSF036P24- AGAAAGAGGATAAAAAAATTAACATCGTTCATTGATCAAATTATTCCTAGAGTCTTCTCA
JMFF037N15+ AGAAAGAGGATAAAAAAATTAACATCGTTCATTGATCAAATTATTCCTAGAGTCTTCTCA
rJMFF037N15- AGAAAGAGGATAAAAAAATTAACATCGTTCATTGATCAAATTATTCCTAGAGTCTTCTCA
JMFF001H14+ AGAAAGAGGATAAAAAAATTAACATCGTTCATTGATCAAATTATTCCTAGAGTCTTCTCA
JMFN034N05+ AGAAAGAGGATAAAAAAATTAACATCGTTCATTGATCAAATTATTCCTAGAGTCTTCTCA
rJMFF001H14- AGAAAGAGGATAAAAAAATTAACATCGTTCATTGATCAAATTATTCCTAGAGTCTTCTCA
JMSF036P24+ AGAAAGAGGATAAAAAAATTAACATCGTTCATTGATCAAATTATTCCTAGAGTCTTCTCA
                      ____________________________________________________________
consensus AGAAAGAGGATAAAAAAATTAACATCGTTCATTGATCAAATTATTCCTAGAGTCTTCTCA
 
. : . : . : . : . : . :
rJMSF036P24- GAGATGTCTGCAACAATCAATGGTGCTTTACCTCAAAAAGGCCATCTGGACCCCATGGAA
JMFF037N15+ GAGATGTCTGCAACAATCAATGGTGCTTTACCTCAAAAAGGCCATCTGGACCCCATGGAA
rJMFF037N15- GAGATGTCTGCAACAATCAATGGTGCTTTACCTCAAAAAGGCCATCTGGACCCCATGGAA
JMFF001H14+ GAGATGTCTGCAACAATCAATGGTGCTTTACCTCAAAAAGGCCATCTGGACCCCATGGAA
JMFN034N05+ GAGATGTCTGCAACAATCAATGGTGCTTTACCTCAAAAAGGCCATCTGGACCCCATGGAA
rJMFF001H14- GAGATGTCTGCAACAATCAATGGTGCTTTACCTCAAAAAGGCCATCTGGACCCCATGGAA
JMSF036P24+ GAGATGTCTGCAACAATCAATGGTGCTTTACCTCAAAAAGGCCATCTGGACCCCATGGAA
                      ____________________________________________________________
consensus GAGATGTCTGCAACAATCAATGGTGCTTTACCTCAAAAAGGCCATCTGGACCCCATGGAA
 
. : . : . : . : . : . :
rJMSF036P24- ACTCCTTATTGCGAATGTGCATGTATGGATATGCAGGGGGTTCCTCGAAGTGGGGATGAC
JMFF037N15+ ACTCCTTATTGCGAATGTGCATGTATGGATATGCAGGGGGTTCCTCGAAGTGGGGATGAC
rJMFF037N15- ACTCCTTATTGCGAATGTGCATGTATGGATATGCAGGGGGTTCCTCGAAGTGGGGATGAC
JMFF001H14+ ACTCCTTATTGCGAATGTGCATGTATGGATATGCAGGGGGTTCCTCGAAGTGGGGATGAC
JMFN034N05+ ACTCCTTATTGCGAATGTGCATGTATGGATATGCAGGGGGTTCCTCGAAGTGGGGATGAC
rJMFF001H14- ACTCCTTATTGCGAATGTGCATGTATGGATATGCAGGGGGTTCCTCGAAGTGGGGATGAC
JMSF036P24+ ACTCCTTATTGCGAATGTGCATGTATGGATATGCAGGGGGTTCCTCGAAGTGGGGATGAC
                      ____________________________________________________________
consensus ACTCCTTATTGCGAATGTGCATGTATGGATATGCAGGGGGTTCCTCGAAGTGGGGATGAC
 
. : . : . : . : . : . :
rJMSF036P24- CCTTGGAAAGATTAACAGCTGCCAGGATAGTACACGCGACTATTCCAGCATAGGTGATTT
JMFF037N15+ CCTTGGAAAGATTAACAGCTGCCAGGATAGTACACGCGACTATTCCAGCATAGGTGATTT
rJMFF037N15- CCTTGGAAAGATTAACAGCTGCCAGGATAGTACACGCGACTATTCCAGCATAGGTGATTT
JMFF001H14+ CCTTGGAAAGATTAACAGCTGCCAGGATAGTACACGCGACTATTCCAGCATAGGTGATTT
JMFN034N05+ CCTTGGAAAGATTAACAGCTGCCAGGATAGTACACGCGACTATTCCAGCATAGGTGATTT
rJMFF001H14- CCTTGGAAAGATTAACAGCTGCCAGGATAGTACACGCGACTATTCCAGCATAGGTGATTT
JMSF036P24+ CCTTGGAAAGATTAACAGCTGCCAGGATAGTACACGCGACTATTCCAGCATAGGTGATTT
                      ____________________________________________________________
consensus CCTTGGAAAGATTAACAGCTGCCAGGATAGTACACGCGACTATTCCAGCATAGGTGATTT
 
. : . : . : . : . : . :
rJMSF036P24- TCTCCCACTTTGAAGCTTCGGCGGCCTCGTCATGATGGGCGGAGGAAGAAAAGCTACGCT
JMFF037N15+ TCTCCCACTTTGAAGCTTCGGCGGCCTCGTCATGATGGGCGGAGGAAGAAAAGCTACGCT
rJMFF037N15- TCTCCCACTTTGAAGCTTCGGCGGCCTCGTCATGATGGGCGGAGGAAGAAAAGCTACGCT
JMFF001H14+ TCTCCCACTTTGAAGCTTCGGCGGCCTCGTCATGATGGGCGGAGGAAGAAAAGCTACGCT
JMFN034N05+ TCTCCCACTTTGAAGCTTCGGCGGCCTCGTCATGATGGGCGGAGGAAGAAAAGCTACGCT
rJMFF001H14- TCTCCCACTTTGAAGCTTCGGCGGCCTCGTCATGATGGGCGGAGGAAGAAAAGCTACGCT
JMSF036P24+ TCTCCCACTTTGAAGCTTCGGCGGCCTCGTCATGATGGGCGGAGGAAGAAAAGCTACGCT
                      ____________________________________________________________
consensus TCTCCCACTTTGAAGCTTCGGCGGCCTCGTCATGATGGGCGGAGGAAGAAAAGCTACGCT
 
. : . : . : . : . : . :
rJMSF036P24- TAGAAGCCGGAGCCCGGCGAGAAACGCCACCGCGGAGGGCGGAGCGGATGCTGGATCTCA
JMFF037N15+ TAGAAGCCGGAGCCCGGCGAGAAACGCCACCGCGGAGGGCGGAGCGGATGCTGGATCTCA
rJMFF037N15- TAGAAGCCGGAGCCCGGCGAGAAACGCCACCGCGGAGGGCGGAGCGGATGCTGGATCTCA
JMFF001H14+ TAGAAGCCGGAGCCCGGCGAGAAACGCCACCGCGGAGGGCGGAGCGGATGCTGGATCTCA
JMFN034N05+ TAGAAGCCGGAGCCCGGCGAGAAACGCCACCGCGGAGGGCGGAGCGGATGCTGGATCTCA
rJMFF001H14- TAGAAGCCGGAGCCCGGCGAGAAACGCCACCGCGGAGGGCGGAGCGGATGCTGGATCTCA
JMSF036P24+ TAGAAGCCGGAGCCCGGCGAGAAACGCCACCGCGGAGGGCGGAGCGGATGCTGGATCTCA
                      ____________________________________________________________
consensus TAGAAGCCGGAGCCCGGCGAGAAACGCCACCGCGGAGGGCGGAGCGGATGCTGGATCTCA
 
. : . : . : . : . : . :
rJMSF036P24- CAATCGTCGACGCCATTCTCTCTCAAATTGACTGACCTTTTGGCTTTTGCGTCTGCGTTC
JMFF037N15+ CAATCGTCGACGCCATTCTCTCTCAAATTGA
rJMFF037N15- CAATCGTCGACGCCATTCTCTCTCAAATTGA
JMFF001H14+ CAATCGTCGACGCCATTCTCTCTCAAATTGA
JMFN034N05+ CAATCGTCGACGCCATTCTCTCTCAAATTGA
rJMFF001H14- CAATCGTCGACGCCATTCTCTCTCAAATTGA
JMSF036P24+ CAATCGTCGACGCCATTCTCTCTCAAATTGACTGACCTTTTGGCTTTTGCGTCTGCGTTC
                      ____________________________________________________________
consensus CAATCGTCGACGCCATTCTCTCTCAAATTGACTGACCTTTTGGCTTTTGCGTCTGCGTTC