Previous Contig 007122:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF004L03Sequence392007122 (8)gb:AY087053_15720892e-40Arabidopsis thaliana clone 3109 mRNA, complete sequence.110013068 (10)
JMSF010H05Sequence379007122 (8)gb:AY087053_15720898e-24Arabidopsis thaliana clone 3109 mRNA, complete sequence.743013068 (10)gb:AY087053_1572089e-110Arabidopsis thaliana clone 3109 mRNA, complete sequence.
JMSF022M23Sequence646007122 (8)gb:AY087053_15720892e-75Arabidopsis thaliana clone 3109 mRNA, complete sequence.611013068 (10)gb:AY087053_15720892e-47Arabidopsis thaliana clone 3109 mRNA, complete sequence.
JMSF036C05Sequence688007122 (8)gb:AY087053_15720895e-74Arabidopsis thaliana clone 3109 mRNA, complete sequence.186013068 (10)gb:AY087053_15720898e-09Arabidopsis thaliana clone 3109 mRNA, complete sequence.
JMSF036P04Sequence343007122 (8)gb:AP003220_18254764e-21Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN604013068 (10)gb:AY087053_15720895e-60Arabidopsis thaliana clone 3109 mRNA, complete sequence.
JMSF038M08Sequence661007122 (8)gb:AY087053_15720891e-68Arabidopsis thaliana clone 3109 mRNA, complete sequence.922013068 (10)gb:AY087053_1572089e-136Arabidopsis thaliana clone 3109 mRNA, complete sequence.
JMSF040L17Sequence690007122 (8)gb:OSJN00151_16957512e-62Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0009P12, complete seque853013068 (10)gb:AY087053_15720893e-92Arabidopsis thaliana clone 3109 mRNA, complete sequence.
JMSF049N20Sequence661007122 (8)gb:AY087053_15720893e-55Arabidopsis thaliana clone 3109 mRNA, complete sequence.712013068 (10)gb:AY087053_15720891e-90Arabidopsis thaliana clone 3109 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022M23+ GTCCG
                      ____________________________________________________________
consensus GTCCG
 
. : . : . : . : . : . :
JMSF022M23+ GAATAGTGAGATTTGTACAAGGTTGCTTGGCCACCACATGTGAGCTGGCTCAACTACGTA
JMSF040L17+ AATAGTGAGATTTGTACAAGGTTGCTTGGCCACCACATGTGAGCTGGCTCAACTACGTA
JMSF036C05+ AATAGTGAGATTTGTACAAGGTTGCTTGGCCACCACATGTGAGCTGGCTCAACTACGTA
JMSF038M08+ CCACATGTGAGCTGGCTCAACTACGTA
                      ____________________________________________________________
consensus GAATAGTGAGATTTGTACAAGGTTGCTTGGCCACCACATGTGAGCTGGCTCAACTACGTA
 
. : . : . : . : . : . :
JMSF022M23+ TTTTCGTAGAAGTCCAGCCCAGCCATACCCAAGAATCTGTGTGGTAAGAATAAGAAGCCA
JMSF040L17+ -TTTCGTAGAAGTCCAGCCCAGCCATACCCAAGAATCTGTGTGGTAAGAATAAGAAGCCA
JMSF036C05+ TTTTCGTAGAAGTCCAGCCCAGCCATACCCAAGAATCTGTGTGGTAAGAATAAGAAGCCA
JMSF049N20+ CTGTGTGGTAAGAATAAGAAGCCA
JMSF038M08+ TTTTCGTAGAAGTCCAGCCCAGCCATACCCAAGAATCTGTGTGGTAAGAATAAGAAGCCA
                      ____________________________________________________________
consensus TTTTCGTAGAAGTCCAGCCCAGCCATACCCAAGAATCTGTGTGGTAAGAATAAGAAGCCA
 
. : . : . : . : . : . :
JMSF022M23+ ACCAGTGTACAAGGAGATTTTCCTCCGATAAAAAGCGATTATAATGTTCACAATCCCAAC
JMSF040L17+ ACCAGTGTACAAGGAGATTTTCCTCCGATAAAAAGCGATTATAATGTTCACAATCCCAAC
JMSF036C05+ ACCAGTGTACAAGGAGATTTTCCTCCGATAAAAAGCGATTATAATGTTCACAATCCCAAC
JMSF049N20+ ACCAGTGTACAAGGAGATTTTCCTCCGATAAAAAGCGATTATAATGTTCACAATCCCAAC
JMSF038M08+ ACCAGTGTACAAGGAGATTTTCCTCCGATAAAAAGCGATTATAATGTTCACAATCCCAAC
                      ____________________________________________________________
consensus ACCAGTGTACAAGGAGATTTTCCTCCGATAAAAAGCGATTATAATGTTCACAATCCCAAC
 
. : . : . : . : . : . :
JMSF004L03+ CCCAGCGTTCGCAAAAATGGTGATCAGAAC
JMSF022M23+ CCCGTAAGCAGTTCCATCTCCAAAGGCAAACCCAGCGTTCGCAAAAATGGTGATCAGAAC
JMSF040L17+ CCCGTAAGCAGTTCCATCTCCAAAGGCAAACCCAGCGTTCGCAAAAATGGTGATCAGAAC
JMSF036C05+ CCCGTAAGCAGTTCCATCTCCAAAGGCAAACCCAGCGTTCGCAAAAATGGTGATCAGAAC
JMSF049N20+ CCCGTAAGCAGTTCCATCTCCAAAGGCAAACCCAGCGTTCGCAAAAATGGTGATCAGAAC
JMSF038M08+ CCCGTAAGCAGTTCCATCTCCAAAGGCAAACCCAGCGTTCGCAAAAATGGTGATCAGAAC
                      ____________________________________________________________
consensus CCCGTAAGCAGTTCCATCTCCAAAGGCAAACCCAGCGTTCGCAAAAATGGTGATCAGAAC
 
. : . : . : . : . : . :
JMSF004L03+ GTGTTCCTTCATGTTAAACGGACCCGGGTTAAGCGAGAATTCCCGGGACCCGAACCCTGG
JMSF022M23+ GTGTTCCTTCATGTTAAACGGACCCGGGTTAAGCGAGAATTCCCGGGACCCGAACCCTGG
JMSF040L17+ GTGTTCCTTCATGTTAAACGGACCCGGGTTAAGCGAGAATTCCCGGGACCCGAACCCTGG
JMSF036C05+ GTGTTCCTTCATGTTAAACGGACCCGGGTTAAGCGAGAATTCCCGGGACCCGAACCCTGG
JMSF049N20+ GTGTTCCTTCATGTTAAACGGACCCGGGTTAAGCGAGAATTCCCGGGACCCGAACCCTGG
JMSF038M08+ GTGTTCCTTCATGTTAAACGGACCCGGGTTAAGCGAGAATTCCCGGGACCCGAACCCTGG
                      ____________________________________________________________
consensus GTGTTCCTTCATGTTAAACGGACCCGGGTTAAGCGAGAATTCCCGGGACCCGAACCCTGG
 
. : . : . : . : . : . :
JMSF004L03+ GACTCGGAACTTCGCCGTCGGCAACGTGGCGGCCATGAACCGGCCGATGGGGAGTGTGGC
JMSF022M23+ GACTCGGAACTTCGCCGTCGGCAACGTGGCGGCCATGAACCGGCCGATGGGGAGTGTGGC
JMSF040L17+ GACTCGGAACTTCGCCGTCGGCAACGTGGCGGCCATGAACCGGCCGATGGGGAGTGTGGC
JMSF036C05+ GACTCGGAACTTCGCCGTCGGCAACGTGGCGGCCATGAACCGGCCGATGGGGAGTGTGGC
JMSF049N20+ GACTCGGAACTTCGCCGTCGGCAACGTGGCGGCCATGAACCGGCCGATGGGGAGTGTGGC
JMSF038M08+ GACTCGGAACTTCGCCGTCGGCAACGTGGCGGCCATGAACCGGCCGATGGGGAGTGTGGC
JMSF010H05+ CGTCGGCAACGTGGCGGCCATGAACCGGCCGATGGGGAGTGTGGC
                      ____________________________________________________________
consensus GACTCGGAACTTCGCCGTCGGCAACGTGGCGGCCATGAACCGGCCGATGGGGAGTGTGGC
 
. : . : . : . : . : . :
JMSF004L03+ CACCTGCGCCGTGATCTGGGTGATGATCAGCGGCTCCTTCCTGTAAGAAAAGAACTGGTT
JMSF022M23+ CACCTGCGCCGTGATCTGGGTGATGATCAGCGGCTCCTTCCTGTAAGAAAAGAACTGGTT
JMSF040L17+ CACCTGCGCCGTGATCTGGGTGATGATCAGCGGCTCCTTCCTGTAAGAAAAGAACTGGTT
JMSF036C05+ CACCTGCGCCGTGATCTGGGTGATGATCAGCGGCTCCTTCCTGTAAGAAAAGAACTGGTT
JMSF049N20+ CACCTGCGCCGTGATCTGGGTGATGATCAGCGGCTCCTTCCTGTAAGAAAAGAACTGGTT
JMSF038M08+ CACCTGCGCCGTGATCTGGGTGATGATCAGCGGCTCCTTCCTGTAAGAAAAGAACTGGTT
JMSF010H05+ CACCTGCGCCGTGATCTGGGTGATGATCAGCGGCTCCTTCCTGTAAGAAAAGAACTGGTT
JMSF036P04+ GGGTGATGATCAGCGGCTCCTTCCTGTAAGAAAAGAACTGNTT
                      ____________________________________________________________
consensus CACCTGCGCCGTGATCTGGGTGATGATCAGCGGCTCCTTCCTGTAAGAAAAGAACTGGTT
 
. : . : . : . : . : . :
JMSF004L03+ GAGGAAGGAGAGGAGGACGCAGGAGAGCAGTCCTAGGACCCACATTCTGAAGGTCCATAC
JMSF022M23+ GAGGAAGGAGAGGAGGACGCAGGAGAGCAGTCCTAGGACCCACATTCTGAAGGTCCATAC
JMSF040L17+ GAGGAAGGAGAGGAGGACGCAGGAGAGCAGTCCTAGGACCCACATTCTGAAGGTCCATAC
JMSF036C05+ GAGGAAGGAGAGGAGGACGCAGGAGAGCAGTCCTAGGACCCACATTCTGAAGGTCCATAC
JMSF049N20+ GAGGAAGGAGAGGAGGACGCAGGAGAGCAGTCCTAGGACCCACATTCTGAAGGTCCATAC
JMSF038M08+ GAGGAAGGAGAGGAGGACGCAGGAGAGCAGTCCTAGGACCCACATTCTGAAGGTCCATAC
JMSF010H05+ GAGGAAGGAGAGGAGGACGCAGGAGAGCAGTCCTAGGACCCACATTCTGAAGGTCCATAC
JMSF036P04+ GAGGAAGGAGAGGAGGACGCAGGAGAGCACTCCTAGGACCCACATTCTGAAGGTCCATAC
                      ____________________________________________________________
consensus GAGGAAGGAGAGGAGGACGCAGGAGAGCAGTCCTAGGACCCACATTCTGAAGGTCCATAC
 
. : . : . : . : . : . :
JMSF004L03+ CGGCAGGGTCGGGTCGTCGGTGTTCGGTACGGTTAGCCGGACTTCCTCCACCGGAGAAAG
JMSF022M23+ CGGCAGGGTCGGGTCGTCGGTGTTCGGTACGGTTAGCCGGACTTCCTCCACCGGAGAAAG
JMSF040L17+ CGGCAGGGTCGGGTCGTCGGTGTTCGGTACGGTTAGCCGGACTTCCTCCACCGGAGAAAG
JMSF036C05+ CGGCAGGGTCGGGTCGTCGGTGTTCGGTACGGTTAGCCGGACTTCCTCCACCGGAGAAAG
JMSF049N20+ CGGCAGGGTCGGGTCGTCGGTGTTCGGTACGGTTAGCCGGACTTCCTCCACCGGAGAAAG
JMSF038M08+ CGGCAGGGTCGGGTCGTCGGTGTTCGGTACGGTTAGCCGGACTTCCTCCACCGGAGAAAG
JMSF010H05+ CGGCAGGGTCGGGTCGTCGGTGTTCGGTACGGTTAGCCGGACTTCCTCCACCGGAGAAAG
JMSF036P04+ CGGCAGGGTCGGGTCGTCGGTGTTCGGTACGGTTAGCCGGACTTCCTCCACCGGAGAAAG
                      ____________________________________________________________
consensus CGGCAGGGTCGGGTCGTCGGTGTTCGGTACGGTTAGCCGGACTTCCTCCACCGGAGAAAG
 
. : . : . : . : . : . :
JMSF004L03+ TTCGTCTTCCTTTATATCTCCTTCATAGATTGTCGGAGCCTCCATTTC
JMSF022M23+ TTCGTCTTCCTTTATATCTCCTTCATAGATTGTCGGAGCCTCCATTTCTACAGAACCCAT
JMSF040L17+ TTCGTCTTCCTTTATATCTCCTTCATAGATTGTCGGAGCCTCCATTTCTACAGAACCCAT
JMSF036C05+ TTCGTCTTCCTTTATATCTCCTTCATAGATTGTCGGAGCCTCCATTTCTACAGAACCCAT
JMSF049N20+ TTCGTCTTCCTTTATATCTCCTTCATAGATTGTCGGAGCCTCCATTTCTACAGAACCCAT
JMSF038M08+ TTCGTCTTCCTTTATATCTCCTTCATAGATTGTCGGAGCCTCCATTTCTACAGAACCCAT
JMSF010H05+ TTCGTCTTCCTTTATATCTCCTTCATAGATTGTCGGAGCCTCCATTTCTACAGAACCCAT
JMSF036P04+ TTNGTCTTCCTTTATATCTCCTTCATAGATTGTCGGAGCCTCCATTTCTACAGAACCCAT
                      ____________________________________________________________
consensus TTCGTCTTCCTTTATATCTCCTTCATAGATTGTCGGAGCCTCCATTTCTACAGAACCCAT
 
. : . : . : . : . : . :
JMSF022M23+ TGTTCTTTAGTGTACAGAAATGGAAAAAAGGATAGATGGT
JMSF040L17+ TGTTCTTTAGTGTACAGAAATGGAAAAAAGGATAGATGGTAGAAAAGGACTAATCAGCCC
JMSF036C05+ TGTTCTTTAGTGTACAGAAATGGAAAAAAGGATAGATGGTAGAAAAGGACTAATCAGCCC
JMSF049N20+ TGTTCTTTAGTGTACAGAAATGGAAAAAAGGATAGATGGTAGAAAAGGACTAATCAGCCC
JMSF038M08+ TGTTCTTTAGTGTACAGAAATGGAAAAAAGGATAGATGGTAGAAAAGGACTAATCAGCCC
JMSF010H05+ TGTTCTTTAGTGTACAGAAATGGAAAAAAGGATAGATGGTAGAAAAGGACTAATCAGCCC
JMSF036P04+ TGTTNTNTAGTGTACAGAAATGGAAAAAAGGATAGATGGTAGAAAAGGNCTAATCAGCCC
                      ____________________________________________________________
consensus TGTTCTTTAGTGTACAGAAATGGAAAAAAGGATAGATGGTAGAAAAGGACTAATCAGCCC
 
. : . : . : . : . : . :
JMSF040L17+ AATTAGAGCTAGCTAGAAACGAAGAGAT
JMSF036C05+ AATTAGAGCTAGCTAGAAACGAAGAGAT
JMSF049N20+ AATTAGAGCTAGCTAGAAACGAAGAGATAATC
JMSF038M08+ AATTAGAGCTAGCTAGAAACGAAGAGATAATC
JMSF010H05+ AATTAGAGCTAGCTAGAAACGAAGAGATAATC
JMSF036P04+ ANTTAGAGCTAGCTAGAAACGAAGAGATAATCCAGCTTGTTGGGTGTTTGCGTGTATAGC
                      ____________________________________________________________
consensus AATTAGAGCTAGCTAGAAACGAAGAGATAATCCAGCTTGTTGGGTGTTTGCGTGTATAGC