Previous Contig 007111:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010D08Sequence575007111 (4)gb:AY085860_15709242e-46Arabidopsis thaliana clone 1911 mRNA, complete sequence.>gb:AY126997_1580454 Ara770007111 (4)gb:AY085860_15709241e-60Arabidopsis thaliana clone 1911 mRNA, complete sequence.>gb:AY126997_1580454 Ara
JMFN015B13Sequence633007111 (4)gb:AY085860_15709244e-58Arabidopsis thaliana clone 1911 mRNA, complete sequence.>gb:AY126997_1580454 Ara
JMSF036M05Sequence240007111 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF010D08- TTTGG
                      ____________________________________________________________
consensus TTTGG
 
. : . : . : . : . : . :
rJMFF010D08- CATTACTTCTATCTCAAAATATTACAACCTTAACAACATTCTTTTTCACTTTTTAATTAA
                      ____________________________________________________________
consensus CATTACTTCTATCTCAAAATATTACAACCTTAACAACATTCTTTTTCACTTTTTAATTAA
 
. : . : . : . : . : . :
rJMFF010D08- AATATACATGATAGAAGGCATAGAGTTTATGGCATGCCAGATTGAGCTACACTATAAAAA
                      ____________________________________________________________
consensus AATATACATGATAGAAGGCATAGAGTTTATGGCATGCCAGATTGAGCTACACTATAAAAA
 
. : . : . : . : . : . :
rJMFF010D08- AACAACAGGAAGCTGAGTGCTTCATATTCCATCCTGTATTCACTTTTATACTATGCAGCC
                      ____________________________________________________________
consensus AACAACAGGAAGCTGAGTGCTTCATATTCCATCCTGTATTCACTTTTATACTATGCAGCC
 
. : . : . : . : . : . :
rJMFF010D08- TGCTTGCTCAATGATGTGTCCAGTGCTCAGGTAGTACTATTATTTCATCCCGGTTTCTGA
                      ____________________________________________________________
consensus TGCTTGCTCAATGATGTGTCCAGTGCTCAGGTAGTACTATTATTTCATCCCGGTTTCTGA
 
. : . : . : . : . : . :
JMFN015B13+ TGCTTATGAATCTGATGGTGGTTGCTGCTGCTGCTGAGGCCACATTGGCTGAGCCA
rJMFF010D08- CTCCTGCTTATGAATCTGATGGTGGTTGCTGCTGCTGCTGAGGCCACATTGGCTGAGCCA
                      ____________________________________________________________
consensus CTCCTGCTTATGAATCTGATGGTGGTTGCTGCTGCTGCTGAGGCCACATTGGCTGAGCCA
 
. : . : . : . : . : . :
JMFN015B13+ TATAGGGACGAGGCTGCTGACCATAAGGAGTTTGATCCACTGGCTTACCCATATACATCC
rJMFF010D08- TATAGGGACGAGGCTGCTGACCATAAGGAGTTTGATCCACTGGCTTACCCATATACATCC
                      ____________________________________________________________
consensus TATAGGGACGAGGCTGCTGACCATAAGGAGTTTGATCCACTGGCTTACCCATATACATCC
 
. : . : . : . : . : . :
JMFN015B13+ CTGAGGTTCCAACCTGAGGAGCAGATTGTGCTTGCATGTAGTAGTATGGAAGCTCTGCAG
rJMFF010D08- CTGAGGTTCCAACCTGAGGAGCAGATTGTGCTTGCATGTAGTAGTATGGAAGCTCTGCAG
                      ____________________________________________________________
consensus CTGAGGTTCCAACCTGAGGAGCAGATTGTGCTTGCATGTAGTAGTATGGAAGCTCTGCAG
 
. : . : . : . : . : . :
JMFN015B13+ GTCCACCAACAGGAAGGGTTCCTCTAGGGATTGATGCAAGCACCTCATCTTTCAAATCCT
rJMFF010D08- GTCCACCAACAGGAAGGGTTCCTCTAGGGATTGATGCAAGCACCTCATCTTTCAAATCCT
                      ____________________________________________________________
consensus GTCCACCAACAGGAAGGGTTCCTCTAGGGATTGATGCAAGCACCTCATCTTTCAAATCCT
 
. : . : . : . : . : . :
JMFN015B13+ CTCTTGGCACAATGTCGACCAAGAAATCAAAGATGTCAGTCCTTGTAATGGCTGCAGCAA
rJMFF010D08- CTCTTGGCACAATGTCGACCAAGAAATCAAAGATGTCAGTCCTTGTAATGGCTGCAGCAA
JMFF010D08+ CTCTTGGCACAATGTCGACCAAGAAATCAAAGATGTCAGTCCTTGTAATGGCTGCAGCAA
                      ____________________________________________________________
consensus CTCTTGGCACAATGTCGACCAAGAAATCAAAGATGTCAGTCCTTGTAATGGCTGCAGCAA
 
. : . : . : . : . : . :
JMFN015B13+ TGTCGTTTTTCTGAAGTGTCCTCCTTTTGTTCTCCTCTGTGTGGTTCCATGCACGCAGTG
rJMFF010D08- TGTCGTTTTTCTGAAGTGTCCTCCTTTTGTTCTCCTCTGTGTGGTTCCATGCACGCAGTG
JMFF010D08+ TGTCGTTTTTCTGAAGTGTCCTCCTTTTGTTCTCCTCTGTGTGGTTCCATGCACGCAGTG
                      ____________________________________________________________
consensus TGTCGTTTTTCTGAAGTGTCCTCCTTTTGTTCTCCTCTGTGTGGTTCCATGCACGCAGTG
 
. : . : . : . : . : . :
JMFN015B13+ TCAACTCAAGGATAAACATCTCACAAGCCCGGGCAAAAACAACAGGTGCTTCTGCTGATA
rJMFF010D08- TCAACTCAAGGATAAACATCTCACAAGCCCGGGCAAAAACAACAGGTGCTTCTGCTGATA
JMFF010D08+ TCAACTCAAGGATAAACATCTCACAAGCCCGGGCAAAAACAACAGGTGCTTCTGCTGATA
                      ____________________________________________________________
consensus TCAACTCAAGGATAAACATCTCACAAGCCCGGGCAAAAACAACAGGTGCTTCTGCTGATA
 
. : . : . : . : . : . :
JMFN015B13+ TCATCCTAACATCTTCGTCTGCCTTCATGATTTTCTTGATCCTTGCCAACGGCAAGCTAT
rJMFF010D08- TCATCCTAACATCTTCGTCTGCCTTCATGATTTTCTTGATCCTTGCCAACGGCAAGCTAT
JMFF010D08+ TCATCCTAACATCTTCGTCTGCCTTCATGATTTTCTTGATCCTTGCCAACGGCAAGCTAT
                      ____________________________________________________________
consensus TCATCCTAACATCTTCGTCTGCCTTCATGATTTTCTTGATCCTTGCCAACGGCAAGCTAT
 
. : . : . : . : . : . :
JMFN015B13+ GGTTCTTGAAATCAG
rJMFF010D08- GGTTCTTGAAATCAGTAACCTGTTCAATTTCTTGGTATTGATTTG
JMFF010D08+ GGTTCTTGAAATCAGTAACCTGTTCAATTTCTTGGTATTGATTTGCCCAGAAAGCCTGAA
                      ____________________________________________________________
consensus GGTTCTTGAAATCAGTAACCTGTTCAATTTCTTGGTATTGATTTGCCCAGAAAGCCTGAA
 
. : . : . : . : . : . :
JMFF010D08+ GTTGTTGCTGCAACTGTTGTTGCTGCTGTTGGTGTATGTGCTGATATGCGAGCTGATGTT
                      ____________________________________________________________
consensus GTTGTTGCTGCAACTGTTGTTGCTGCTGTTGGTGTATGTGCTGATATGCGAGCTGATGTT
 
. : . : . : . : . : . :
JMFF010D08+ GTGCCATCTGAGATGAAGAGGCGGGAAGACCTGGTGGTGGCTGTCCGTTTCCATGCTGAT
                      ____________________________________________________________
consensus GTGCCATCTGAGATGAAGAGGCGGGAAGACCTGGTGGTGGCTGTCCGTTTCCATGCTGAT
 
. : . : . : . : . : . :
JMFF010D08+ CCATTTCACCTCTTTCAACTTGCAGGGAAACTCAGGGATATTTTATTTCCTGAACAGAAA
                      ____________________________________________________________
consensus CCATTTCACCTCTTTCAACTTGCAGGGAAACTCAGGGATATTTTATTTCCTGAACAGAAA
 
. : . : . : . : . : . :
JMFF010D08+ TTATCGCCGGTGAATTCTTGCTTCCTCCCGGCGATAAAACAAAAACAAAGAAGAAAAAAG
JMSF036M05+ ACAAAGAAGAAAAAAG
                      ____________________________________________________________
consensus TTATCGCCGGTGAATTCTTGCTTCCTCCCGGCGATAAAACAAAAACAAAGAAGAAAAAAG
 
. : . : . : . : . : . :
JMFF010D08+ CGAAGGTTGAAGAGAGAGAGAGAGAGAGTGTGTGT
JMSF036M05+ CGAAGGTTGAAGAGAGAGAGAGAGAGAGTGTGTGTGTGTTTTAGGGTTGAATGATCAGCC
                      ____________________________________________________________
consensus CGAAGGTTGAAGAGAGAGAGAGAGAGAGTGTGTGTGTGTTTTAGGGTTGAATGATCAGCC