Previous Contig 007107:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF042L21Sequence542007107 (23)
JMFN003E21Sequence513007107 (23)
JMFN005F14Sequence545007107 (23)
JMFN007L06Sequence536007107 (23)
JMFN008B12Sequence513007107 (23)
JMFN009A11Sequence583007107 (23)
JMFN009K12Sequence619007107 (23)
JMFN010H15Sequence569007107 (23)
JMFN010I03Sequence562007107 (23)
JMFN011C20Sequence585007107 (23)
JMFN012C07Sequence589007107 (23)
JMFN013I12Sequence619007107 (23)
JMFN019A21Sequence576007107 (23)
JMFN032N19Sequence531007107 (23)
JMFN035E24Sequence551007107 (23)
JMFN040B13Sequence614007107 (23)
JMFN040N24Sequence464007107 (23)
JMFN042M12Sequence535007107 (23)
JMSF036L04Sequence589007107 (23)534007107 (23)
JMSF040O22Sequence529007107 (23)145000711 (6)gb:AY389717_11783306e-06Hyacinthus orientalis mago nashi-like protein mRNA, partial cds.
JMSF050G05Sequence504007107 (23)449007107 (23)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN010H15+ AAAATAGAAAATTATTAAATTTTTTAATTTA-TTTTTTGCAA
JMFN009A11+ AAAATAGAAAATTATTAAATTTTTTAATTTATTTTTTTGCAA
JMFN012C07+ ATTATTAAATTTTTTAATTTATTTTTTTGCAA
                      ____________________________________________________________
consensus AAAATAGAAAATTATTAAATTTTTTAATTTATTTTTTTGCAA
 
. : . : . : . : . : . :
JMFN010H15+ ACGTTTGGAGTTTTACCATGTTTAATTAGAAATAAACACTTTTGAAGCAATAATCCATTA
JMFN009A11+ ACGTTTGGAGTTTTACCATGTTTAATTAGAAATAAACACTTTTGAAGCAATAATCCATTA
JMFN012C07+ ACGTTTGGAGTTTTACCATGTTTAATTAGAAATAAACACTTTTGAAGCAATAATCCATTA
JMFN013I12+ TTTAATTAGAAATAAACACTTNTGAAGCAATAATCCATTA
JMFN040B13+ AATTAGAAATAAACACTTTTGAAGCAATAATCCATTA
JMFN032N19+ A
JMFN011C20+ GAAGCAATAATCCATTA
JMFN008B12+ AAGCAATAATCCATTA
JMFF042L21+ AGAAATAAACACTTTTGAAGCAATAATCCATTA
JMFN042M12+ ATTAGAAATAAACACTTTTGAAGCAATAATCCATTA
JMFN007L06+ TTAGAAATAAACACTTTTGAAGCAATAATCCATTA
JMFN010I03+ AATTAGAAATAAACACTTTTGAAGCAATAATCCATTA
JMFN003E21+ GAAGCAATAATCCATTA
JMFN009K12+ TTTAATTAGAAATAAACACTTTTGAAGCAATAATCCATTA
                      ____________________________________________________________
consensus ACGTTTGGAGTTTTACCATGTTTAATTAGAAATAAACACTTTTGAAGCAATAATCCATTA
 
. : . : . : . : . : . :
JMFN010H15+ AGTACAGCGAGCTATAAGGTTGTCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
JMFN009A11+ AGTACAGCGAGCTATAAGGTTGTCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
JMFN012C07+ AGTACAGCGAGCTATAAGGTTGTCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
JMFN013I12+ AGTACAGCGAGCTATAAGGTTGTCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
JMFN040B13+ AGTACAGCGAGCTATAAGGTTGTCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
JMFN032N19+ AGTACAGCGAGCTATAAGGTTGTCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
JMFN011C20+ AGTACAGCGAGCTATAAGGTTGTCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
JMFN019A21+ CAGCGAGCTATAAGGTTGTCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
JMFN008B12+ AGTACAGCGAGCTATAAGGTTGTCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
JMFN040N24+ AAACGGCGGTCCAAATTATTTATCAAATGACAG
JMFF042L21+ AGTACAGCGAGCTATAAGGTTGTCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
JMFN042M12+ AGTACAGCGAGCTATAAGGTTGTCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
JMFN007L06+ AGTACAGCGAGCTATAAGGTTGTCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
JMSF040O22+ CAGCGAGCTATAAGGTTGTCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
JMSF050G05+ TTGTCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
JMFN010I03+ AGTACAGCGAGCTATAAGGTTGTCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
JMFN005F14+ CTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
JMFN003E21+ AGTACAGCGAGCTATAAGGTTGTCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
JMFN009K12+ AGTACAGCGAGCTATAAGGTTGTCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
JMFN035E24+ TCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
JMSF036L04+ TTGTCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
                      ____________________________________________________________
consensus AGTACAGCGAGCTATAAGGTTGTCTTGAAACGGCGGTCCAAATTATTTATCAAATGACAG
 
. : . : . : . : . : . :
JMFN010H15+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMFN009A11+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMFN012C07+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMFN013I12+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMFN040B13+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMFN032N19+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMFN011C20+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMFN019A21+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMFN008B12+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMFN040N24+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMFF042L21+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMFN042M12+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMFN007L06+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMSF040O22+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMSF050G05+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMFN010I03+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
rJMSF050G05- AAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMFN005F14+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMFN003E21+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMFN009K12+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMFN035E24+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
rJMSF036L04- AAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
JMSF036L04+ AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
                      ____________________________________________________________
consensus AATACAAAAGTAAATGCTAACTACTATGGCACTTCTCAATCATACGATAGAAACAATCTC
 
. : . : . : . : . : . :
JMFN010H15+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
JMFN009A11+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
JMFN012C07+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
JMFN013I12+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
JMFN040B13+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
JMFN032N19+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
JMFN011C20+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
JMFN019A21+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCATCAG
JMFN008B12+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
JMFN040N24+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
JMFF042L21+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
JMFN042M12+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
JMFN007L06+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
JMSF040O22+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
JMSF050G05+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
JMFN010I03+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
rJMSF050G05- ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
JMFN005F14+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
JMFN003E21+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
JMFN009K12+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
JMFN035E24+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
rJMSF036L04- ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
JMSF036L04+ ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
                      ____________________________________________________________
consensus ACGGCCATGATGCGCCGGCGGCCCGTCGATCAAAAGCATGCTTCTAGAACACAGCAACAG
 
. : . : . : . : . : . :
JMFN010H15+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMFN009A11+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMFN012C07+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMFN013I12+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMFN040B13+ CACAGC---GCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMFN032N19+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMFN011C20+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMFN019A21+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMFN008B12+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMFN040N24+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMFF042L21+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMFN042M12+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMFN007L06+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMSF040O22+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMSF050G05+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMFN010I03+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
rJMSF050G05- CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMFN005F14+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMFN003E21+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMFN009K12+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMFN035E24+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
rJMSF036L04- CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
JMSF036L04+ CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
                      ____________________________________________________________
consensus CACAGCGCAGCCAAACATCCTTCCATGCAGCCGACGCCACTGGACTGCTTTTGCTGCGGC
 
. : . : . : . : . : . :
JMFN010H15+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMFN009A11+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMFN012C07+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMFN013I12+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMFN040B13+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMFN032N19+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMFN011C20+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMFN019A21+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMFN008B12+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMFN040N24+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMFF042L21+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMFN042M12+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMFN007L06+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMSF040O22+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMSF050G05+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMFN010I03+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
rJMSF050G05- GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMFN005F14+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMFN003E21+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMFN009K12+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMFN035E24+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
rJMSF036L04- GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
JMSF036L04+ GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
                      ____________________________________________________________
consensus GGAGGAGCACCGTACTGGGGAGCATACTGCGGCGGCGGATACCCCTGCTGCGGCGGATAT
 
. : . : . : . : . : . :
JMFN010H15+ CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMFN009A11+ CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMFN012C07+ CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMFN013I12+ CCCTGCTGCGGAGGATAGCCT-CATGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMFN040B13+ CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMFN032N19+ CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMFN011C20+ CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMFN019A21+ CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMFN008B12+ CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMFN040N24+ CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMFF042L21+ CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMFN042M12+ CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMFN007L06+ CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMSF040O22+ CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMSF050G05+ CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMFN010I03+ CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
rJMSF050G05- CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMFN005F14+ CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMFN003E21+ CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMFN009K12+ CCCTGCTGCGGAGGATAGCCT-CATGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMFN035E24+ CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
rJMSF036L04- CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
JMSF036L04+ CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
                      ____________________________________________________________
consensus CCCTGCTGCGGAGGATAGCCTCCTTGAGGGTACCCCTGCGGGGGGTAACCCGGCGGCGGG
 
. : . : . : . : . : . :
JMFN010H15+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMFN009A11+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMFN012C07+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMFN013I12+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMFN040B13+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMFN032N19+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMFN011C20+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMFN019A21+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMFN008B12+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMFN040N24+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMFF042L21+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMFN042M12+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMFN007L06+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMSF040O22+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMSF050G05+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMFN010I03+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
rJMSF050G05- TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMFN005F14+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMFN003E21+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMFN009K12+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMFN035E24+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
rJMSF036L04- TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
JMSF036L04+ TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
                      ____________________________________________________________
consensus TAAGCATCCTTAGGCGGATAACCTTGTGGAGGAGGAACGCCGACGGGAGGATGGCCCTGA
 
. : . : . : . : . : . :
JMFN010H15+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACG
JMFN009A11+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
JMFN012C07+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
JMFN013I12+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
JMFN040B13+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
JMFN032N19+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
JMFN011C20+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
JMFN019A21+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
JMFN008B12+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
JMFN040N24+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
JMFF042L21+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
JMFN042M12+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
JMFN007L06+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
JMSF040O22+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
JMSF050G05+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
JMFN010I03+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
rJMSF050G05- TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
JMFN005F14+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
JMFN003E21+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
JMFN009K12+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
JMFN035E24+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
rJMSF036L04- TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
JMSF036L04+ TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
                      ____________________________________________________________
consensus TCGTAATAACTCATGATCGGACTTTTCCCGGAGTTTGGTAGACTGACGCTAAATCAACCT
 
. : . : . : . : . : . :
JMFN009A11+ C
JMFN012C07+ CGAGAGAGAAGCAAAAG
JMFN013I12+ CGAGAGAGAAGCAAAAGTACTAGACGCAAGAGATAGGGGACAGAGTTGGATATAATGAGA
JMFN040B13+ CGAGAGAGAAGCAAAAGTACTAGACGCAAGAGATAGGGGACAGAGTTGGATATAATGAGA
JMFN032N19+ CGAGAGAGAAGCAAAAGTACTAGACGCAAGAGATAGGGGACAGAGTTGGA
JMFN011C20+ CGAGAGAGAAGCAAAAGTACTAGACGCAAGAGATAGGGGACAGAGTTGGATATAATGAGA
JMFN019A21+ CGAGAGAGAAGCAAAAGTACTAGACGCAAGAGATAGGGGACAGAGTTGGATATAATGAGA
JMFN008B12+ CGAGAGAGAAGCAAAAG
JMFN040N24+ CGAGAGAGAAG
JMFF042L21+ CGAGAGAGAAGCAAAAGTACTAGACGCAA
JMFN042M12+ CGAGAGAGAAGCAAAAGTA
JMFN007L06+ CGAGAGAGAAGCAAAAG
JMSF040O22+ CGAGAGAGAAGCAAAAGTACTAGACGCAAGAGATAGGGGAC
JMSF050G05+ CGAGAGAGAAGCAAAAGTACTAGACGCAAGAGAT
JMFN010I03+ CGAGAGAGAAGCAAAAGTACTAGACGCAAGAGATAGGGGACAGAG
rJMSF050G05- CGAGAGAGAAGCAAAAGTACTAGACGCAAGAGAT
JMFN005F14+ CGAGAGAGAAGCAAAAGTACTAGACGCAAGAGATAGGGGACAGAGTTGGATATAATGAGA
JMFN003E21+ CGAGAGAGAAGCAAAA
JMFN009K12+ CGAGAGAGAAGCAAAAGTACTAGACGCAAGAGATAGGGGACAGAGTTGGATATAATGAGA
JMFN035E24+ CGAGAGAGAAGCAAAAGTACTAGACGCAAGAGATAGGGGACAGAGTTGGATATAATGAGA
rJMSF036L04- CGAGAGAGAAGCAAAAGTACTAGACGCAAGAGATAGGGGACAGAGTTGGATATAATGAGA
JMSF036L04+ CGAGAGAGAAGCAAAAGTACTAGACGCAAGAGATAGGGGACAGAGTTGGATATAATGAGA
                      ____________________________________________________________
consensus CGAGAGAGAAGCAAAAGTACTAGACGCAAGAGATAGGGGACAGAGTTGGATATAATGAGA
 
. : . : . : . : . : . :
JMFN013I12+ TTTATAGGGGTGTTAACGACAGATAAAATGCTATATTAGA
JMFN040B13+ TTTATAGGGGTGTTAACGACAGATAAAATGCTATATTAGA
JMFN011C20+ TTTATAGGGGTGTTAACGACAGATAAAA
JMFN019A21+ TTTATAGGGGTGTTAACGACAGATAAAATGCTATATTAGA
JMFN005F14+ TTTATAGGGGTGTTAACGACAGATAAAA
JMFN009K12+ TTTATAGGGGTGTTAACGACAGATAAAATGCTATATTAGA
JMFN035E24+ TTTATAGGGGTGTTAACGACAGATAAAATGCTA
rJMSF036L04- TTTATAGGGGTGTTAACGACAGATAAAATGCTATATTAGACAGGTAAGAGGTTACAACTC
JMSF036L04+ TTTATAGGGGTGTTAACGACAGATAAAATGCTATATTAGACAGGTAAGAGGTTACAACTC
                      ____________________________________________________________
consensus TTTATAGGGGTGTTAACGACAGATAAAATGCTATATTAGACAGGTAAGAGGTTACAACTC