Previous Contig 007105:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF027C15Sequence669013054 (3)gb:AB023044_15154902e-36Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWD22.>gb:BT012354_1641726007105 (2)gb:AK117622_18156471e-18Arabidopsis thaliana At5g54610 mRNA for putative ankyrin-repeat-containing prote
JMSF036K23Sequence681007105 (2)gb:AK117622_18156477e-12Arabidopsis thaliana At5g54610 mRNA for putative ankyrin-repeat-containing prote694013054 (3)gb:AB023044_15154901e-25Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MWD22.>gb:BT012354_1641

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF027C15+ TTCAGGTGCTCCACTAAGACCTTGAGAACCTCATANTTGATAGTTCA
                      ____________________________________________________________
consensus TTCAGGTGCTCCACTAAGACCTTGAGAACCTCATANTTGATAGTTCA
 
. : . : . : . : . : . :
rJMSF027C15+ TCACTGCAAGGTGAAGCGCAGACTCATTACGAGATGTTACGTAAGCTATGGAATCACCCG
                      ____________________________________________________________
consensus TCACTGCAAGGTGAAGCGCAGACTCATTACGAGATGTTACGTAAGCTATGGAATCACCCG
 
. : . : . : . : . : . :
rJMSF027C15+ AAGCTCCAAGCAGTTCTTCAACAACTTCGACTCTTCCTTTTACTGCTGCACAGTGAAGAG
JMSF036K23+ TTACTGCTGCACAGTGAAGAG
                      ____________________________________________________________
consensus AAGCTCCAAGCAGTTCTTCAACAACTTCGACTCTTCCTTTTACTGCTGCACAGTGAAGAG
 
. : . : . : . : . : . :
rJMSF027C15+ GAATCCTTTGTTCTCTTCCCTTGACCAGGTAAAGATTGCTATCTATTTTCAGCAGTTCTC
JMSF036K23+ GAATCCTTTGTTCTCTTCCCTTGACCAGGTAAAGATTGCTATCTATTTTCAGCAGTTCTC
                      ____________________________________________________________
consensus GAATCCTTTGTTCTCTTCCCTTGACCAGGTAAAGATTGCTATCTATTTTCAGCAGTTCTC
 
. : . : . : . : . : . :
rJMSF027C15+ TTGTAATCTCGATATTCCCAGCTGCAGAGGCGATATGCAATGGGGTCAAACCATTTTGAT
JMSF036K23+ TNGTAATCTCGATATTCCCAGCTGCAGAGGCGATATGCAATGGGGTCAAACCATTTTGAT
                      ____________________________________________________________
consensus TTGTAATCTCGATATTCCCAGCTGCAGAGGCGATATGCAATGGGGTCAAACCATTTTGAT
 
. : . : . : . : . : . :
rJMSF027C15+ TCAGCTCCATAGCGAATTCTTTCTTAAGCTCAATCACCTTCTTCACAAAACCAACGTGCC
JMSF036K23+ TCAGCTCCATAGCGAATTCTTTCTTAAGCTCAATCACCTTCTTCACAAAACCAACGTGCC
                      ____________________________________________________________
consensus TCAGCTCCATAGCGAATTCTTTCTTAAGCTCAATCACCTTCTTCACAAAACCAACGTGCC
 
. : . : . : . : . : . :
rJMSF027C15+ CTGCAATACAAGCAATGTGTAGTGGATTTTCTCCACCTTCCAACAAAACAGTATGCAGCA
JMSF036K23+ CTGCAATACAAGCAATGTGTAGTGGATTTTCTCCACCTTCCAACAAAACAGTATGCAGCA
                      ____________________________________________________________
consensus CTGCAATACAAGCAATGTGTAGTGGATTTTCTCCACCTTCCAACAAAACAGTATGCAGCA
 
. : . : . : . : . : . :
rJMSF027C15+ AAAGGGGATGATCTTCTGTCAGTCTCAGCAAGCCTTCCACGTTTCCTGTCATGGCAATCT
JMSF036K23+ AAAGGGGATGATCTTCTGTCAGTCTCAGCAAGCCTTCCACGTTTCCTGTCATGGCAATCT
                      ____________________________________________________________
consensus AAAGGGGATGATCTTCTGTCAGTCTCAGCAAGCCTTCCACGTTTCCTGTCATGGCAATCT
 
. : . : . : . : . : . :
rJMSF027C15+ CACACAGCCTTTCATCCATTCCTCCGATGGAAGATAACAACTATAGTATCACTTCCTGCA
JMSF036K23+ CACACAGCCTTTCATCCATTCCTCCGATGGAAGATAACAACTATAGTATCACTTCCTGCA
                      ____________________________________________________________
consensus CACACAGCCTTTCATCCATTCCTCCGATGGAAGATAACAACTATAGTATCACTTCCTGCA
 
. : . : . : . : . : . :
rJMSF027C15+ GTCAGGTCAATTTATATAAAGATTTAAAGAAAGACTCCTGTCAATGTGAACCCCATAAAT
JMSF036K23+ GTCAGGTCAATTTATATAAAGATTTAAAGAAAGACTCCTGTCAATGTGAACCCCATAAAT
                      ____________________________________________________________
consensus GTCAGGTCAATTTATATAAAGATTTAAAGAAAGACTCCTGTCAATGTGAACCCCATAAAT
 
. : . : . : . : . : . :
rJMSF027C15+ TAAGAAGTTTTTTGTCACATCAGTTTAGTTTGACTAAGAGCCTATTTATATAGATTAACT
JMSF036K23+ TAAGAAGTTTTTTGTCACATCAGTTTAGTTTGACTAAGAGCCTATTTATATAGATTAACT
                      ____________________________________________________________
consensus TAAGAAGTTTTTTGTCACATCAGTTTAGTTTGACTAAGAGCCTATTTATATAGATTAACT
 
. : . : . : . : . : . :
rJMSF027C15+ TGCAGCTTACATCACATTTACTCATGCTCTGCCAAGATGTTATATATTAATATATATAAC
JMSF036K23+ TGCAGCTTACATCACATTTACTCATGCTCTGCCAAGATGTTATATATTAATATATATAAC
                      ____________________________________________________________
consensus TGCAGCTTACATCACATTTACTCATGCTCTGCCAAGATGTTATATATTAATATATATAAC
 
. : . : . : . : . : . :
rJMSF027C15+ AGAAACTGTGTTCAAACCT
JMSF036K23+ AGAAACTGTGTTCAAACCTCAAGGCCTCGCACAAGTGATAAGAATCTTGAAGTCAGAATC
                      ____________________________________________________________
consensus AGAAACTGTGTTCAAACCTCAAGGCCTCGCACAAGTGATAAGAATCTTGAAGTCAGAATC
 
. : . : . : . : . : . :
JMSF036K23+ CTTAGCAATGGATTCGAAACACAAATCAAAGCTCTAATTGCATTTTTGTGGAAAAGCTCC
                      ____________________________________________________________
consensus CTTAGCAATGGATTCGAAACACAAATCAAAGCTCTAATTGCATTTTTGTGGAAAAGCTCC