Previous Contig 007100:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS092D07Sequence622007100 (2)gb:AF264147_17818237e-77Gossypium hirsutum monofunctional lysine-ketoglutarate reductase 1 mRNA, complet
JMSF036I18Sequence653007100 (2)gb:AF264147_17818237e-78Gossypium hirsutum monofunctional lysine-ketoglutarate reductase 1 mRNA, complet717023724gb:AF264146_17818224e-53Gossypium hirsutum bifunctional lysine-ketoglutarate reductase/saccharopine dehy

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS092D07+ GATACCATTGTCCTAGCCCACGTAAAAAATCAATCATTCCAGCTC
JMSF036I18+ AAGGTTAAGATACCATTGTCCTAGCCCACGTAAAAAATCAATCATTCCAGCTC
                      ____________________________________________________________
consensus AAGGTTAAGATACCATTGTCCTAGCCCACGTAAAAAATCAATCATTCCAGCTC
 
. : . : . : . : . : . :
JMFS092D07+ TACCAGCAAACTTCCCAAATGCAAGTAGCCTCTTCCCATGATCTCCAACTATAAGTTCAT
JMSF036I18+ TACCAGCAAACTTCCCAAATGCAAGTAGCCTCTTCCCATGATCTCCAACTATAAGTTCAT
                      ____________________________________________________________
consensus TACCAGCAAACTTCCCAAATGCAAGTAGCCTCTTCCCATGATCTCCAACTATAAGTTCAT
 
. : . : . : . : . : . :
JMFS092D07+ AATCATACAATGACGCCTTTGATGCTAAGATCTTATCTAACAAAGGCATATTTTCCTTTT
JMSF036I18+ AATCATACAATGACGCCTTTGATGCTAAGATCTTATCTAACAAAGGCATATTTTCCTTTT
                      ____________________________________________________________
consensus AATCATACAATGACGCCTTTGATGCTAAGATCTTATCTAACAAAGGCATATTTTCCTTTT
 
. : . : . : . : . : . :
JMFS092D07+ GTGCCTTGTGAGTATGGGAAAAAAATGCATAAGCCCTGTCAGGAAGAATCATATCCAACT
JMSF036I18+ GTGCCTTGTGAGTATGGGAAAAAAATGCATAAGCCCTGTCAGGAAGAATCATATCCAACT
                      ____________________________________________________________
consensus GTGCCTTGTGAGTATGGGAAAAAAATGCATAAGCCCTGTCAGGAAGAATCATATCCAACT
 
. : . : . : . : . : . :
JMFS092D07+ TGGGTTGTTTGATTCCCAATATGAGACCACACTCTGACAAGTCCTCAGATACCTCACAAC
JMSF036I18+ TGGGTTGTTTGATTCCCAATATGAGACCACACTCTGACAAGTCCTCAGATACCTCACAAC
                      ____________________________________________________________
consensus TGGGTTGTTTGATTCCCAATATGAGACCACACTCTGACAAGTCCTCAGATACCTCACAAC
 
. : . : . : . : . : . :
JMFS092D07+ CAACATCCTCATAGAGTGCATCATGATGAATGCGCTTGGTGGATGGCTGCACAACAATGC
JMSF036I18+ CAACATCCTCATAGAGTGCATCATGATGAATGCGCTTGGTGGATGGCTGCACAACAATGC
                      ____________________________________________________________
consensus CAACATCCTCATAGAGTGCATCATGATGAATGCGCTTGGTGGATGGCTGCACAACAATGC
 
. : . : . : . : . : . :
JMFS092D07+ GGGCCACTCCAGTTTTACCTTTGCCACCATGCAGCAGTCGAGCACAATGTGAAGGGGTGA
JMSF036I18+ GGGCCACTCCAGTTTTACCTTTGCCACCATGCAGCAGTCGAGCACAATGTGAAGGGGTGA
                      ____________________________________________________________
consensus GGGCCACTCCAGTTTTACCTTTGCCACCATGCAGCAGTCGAGCACAATGTGAAGGGGTGA
 
. : . : . : . : . : . :
JMFS092D07+ GAGGAACCCTCCTTTCCCACTTGTTAGTAGACTCAGCGAGGACTCCAACAATCCCATTGC
JMSF036I18+ GAGGAACCCTCCTTTCCCACTTGTTAGTAGACTCAGCGAGGACTCCAACAATCCCATTGC
                      ____________________________________________________________
consensus GAGGAACCCTCCTTTCCCACTTGTTAGTAGACTCAGCGAGGACTCCAACAATCCCATTGC
 
. : . : . : . : . : . :
JMFS092D07+ CAAGCATGGTTACTACCTAAGGCTGGCAAAAAAGCTGCCGCCGATTCGCCGTCCGTACGT
JMSF036I18+ CAAGCATGGTTACTACCTAAGGCTGGCAAAAAAGCTGCCGCCGATTCGCCGTCCGTACGT
                      ____________________________________________________________
consensus CAAGCATGGTTACTACCTAAGGCTGGCAAAAAAGCTGCCGCCGATTCGCCGTCCGTACGT
 
. : . : . : . : . : . :
JMFS092D07+ CCGTCGGGAAAGGTCGAGTGATGCAAATCAGCAAATGTGATTTACGACGACGGATGTGAA
JMSF036I18+ CCGTCGGGAAAGGTCGAGTGATGCAAATCAGCAAATGTGATTTACGACGACGGATGTGAA
                      ____________________________________________________________
consensus CCGTCGGGAAAGGTCGAGTGATGCAAATCAGCAAATGTGATTTACGACGACGGATGTGAA
 
. : . : . : . : . : . :
JMFS092D07+ ACTGAAAGTGAAACAGACAGATTGATGATTAAGCGAT
JMSF036I18+ ACTGAAAGTGAAACAGACAGATTGATGATTAAGCGATAAACAATTCTATAGTCCCAAGCC
                      ____________________________________________________________
consensus ACTGAAAGTGAAACAGACAGATTGATGATTAAGCGATAAACAATTCTATAGTCCCAAGCC