Previous Contig 007099:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF036I16Sequence371007099 (4)gb:AY630790_16186822e-20Arabidopsis thaliana hypothetical protein (At4G00530) mRNA, complete cds.321007099 (4)gb:AY630790_16186822e-20Arabidopsis thaliana hypothetical protein (At4G00530) mRNA, complete cds.
JMSF037H06Sequence371007099 (4)gb:AY630790_16186822e-20Arabidopsis thaliana hypothetical protein (At4G00530) mRNA, complete cds.321007099 (4)gb:AY630790_16186822e-20Arabidopsis thaliana hypothetical protein (At4G00530) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037H06- TGAGTGCATTC
rJMSF037H06+ TGAGTGCATTC
rJMSF036I16+ TGAGTGCATTC
JMSF036I16- TGAGTGCATTC
                      ____________________________________________________________
consensus TGAGTGCATTC
 
. : . : . : . : . : . :
JMSF037H06- TTCTTCAAGCAGAAAATTTCAAATAGAAGGAAATGATGGACCCCAAAACTGACAAGCTGG
rJMSF037H06+ TTCTTCAAGCAGAAAATTTCAAATAGAAGGAAATGATGGACCCCAAAACTGACAAGCTGG
rJMSF036I16+ TTCTTCAAGCAGAAAATTTCAAATAGAAGGAAATGATGGACCCCAAAACTGACAAGCTGG
JMSF036I16- TTCTTCAAGCAGAAAATTTCAAATAGAAGGAAATGATGGACCCCAAAACTGACAAGCTGG
                      ____________________________________________________________
consensus TTCTTCAAGCAGAAAATTTCAAATAGAAGGAAATGATGGACCCCAAAACTGACAAGCTGG
 
. : . : . : . : . : . :
JMSF037H06- TGAGAAGGACGACTATGGTGGCCACTGCTGTTGCTTCTTATTTCCTTCTCACTGCTGATT
rJMSF037H06+ TGAGAAGGACGACTATGGTGGCCACTGCTGTTGCTTCTTATTTCCTTCTCACTGCTGATT
rJMSF036I16+ TGAGAAGGACGACTATGGTGGCCACTGCTGTTGCTTCTTATTTCCTTCTCACTGCTGATT
JMSF036I16- TGAGAAGGACGACTATGGTGGCCACTGCTGTTGCTTCTTATTTCCTTCTCACTGCTGATT
                      ____________________________________________________________
consensus TGAGAAGGACGACTATGGTGGCCACTGCTGTTGCTTCTTATTTCCTTCTCACTGCTGATT
 
. : . : . : . : . : . :
JMSF037H06- ATGGCCCCGAACCCAACGCCCTCGACCCTATTAAAAACGCTATACTTTCAGCAGAACGAT
rJMSF037H06+ ATGGCCCCGAACCCAACGCCCTCGACCCTATTAAAAACGCTATACTTTCAGCAGAACGAT
rJMSF036I16+ ATGGCCCCGAACCCAACGCCCTCGACCCTATTAAAAACGCTATACTTTCAGCAGAACGAT
JMSF036I16- ATGGCCCCGAACCCAACGCCCTCGACCCTATTAAAAACGCTATACTTTCAGCAGAACGAT
                      ____________________________________________________________
consensus ATGGCCCCGAACCCAACGCCCTCGACCCTATTAAAAACGCTATACTTTCAGCAGAACGAT
 
. : . : . : . : . : . :
JMSF037H06- CTGTAAAGGAGTTTATCTTTGGACCAAAGAAGAGTGTTGAGGAAAACGAGATTGAGAAAG
rJMSF037H06+ CTGTAAAGGAGTTTATCTTTGGACCAAAGAAGAGTGTTGAGGAAAACGAGATTGAGAAAG
rJMSF036I16+ CTGTAAAGGAGTTTATCTTTGGACCAAAGAAGAGTGTTGAGGAAAACGAGATTGAGAAAG
JMSF036I16- CTGTAAAGGAGTTTATCTTTGGACCAAAGAAGAGTGTTGAGGAAAACGAGATTGAGAAAG
                      ____________________________________________________________
consensus CTGTAAAGGAGTTTATCTTTGGACCAAAGAAGAGTGTTGAGGAAAACGAGATTGAGAAAG
 
. : . : . : . : . : . :
JMSF037H06- CCCCAACTGGTGTGGAGAAACACTGAAAGCAGCCTTTTGTTAACTACTACCTTTGCTTAT
rJMSF037H06+ CCCCAACTGGTGTGGAGAAACACTGAAAGCAGCCTTTTGTTAACTACTACCTTTGCTTAT
rJMSF036I16+ CCCCAACTGGTGTGGAGAAACACTGAAAGCAGCCTTTTGTTAACTACTACCTTTGCTTAT
JMSF036I16- CCCCAACTGGTGTGGAGAAACACTGAAAGCAGCCTTTTGTTAACTACTACCTTTGCTTAT
                      ____________________________________________________________
consensus CCCCAACTGGTGTGGAGAAACACTGAAAGCAGCCTTTTGTTAACTACTACCTTTGCTTAT
 
. : . : . : . : . : . :
JMSF037H06- AAAAGAATTTTGTTTGTAGGATTTGCTTATAAAGTTACAACTTTATACTCAAAAAAAAAA
rJMSF037H06+ AAAAGAATTT
rJMSF036I16+ AAAAGAATTT
JMSF036I16- AAAAGAATTTTGTTTGTAGGATTTGCTTATAAAGTTACAACTTTATACTCAAAAAAAAAA
                      ____________________________________________________________
consensus AAAAGAATTTTGTTTGTAGGATTTGCTTATAAAGTTACAACTTTATACTCAAAAAAAAAA