Previous Contig 007098:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN034N16Sequence585007098 (6)gb:AB015476_15126122e-07Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNC6.>gb:AY084399_15694
JMSF004F09Sequence474007098 (6)gb:AB015476_15126121e-07Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNC6.>gb:AY084399_15694469007098 (6)gb:AB015476_15126123e-07Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNC6.>gb:AY084399_15694
JMSF004F11Sequence381018363476007098 (6)gb:AB015476_15126121e-07Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNC6.>gb:AY084399_15694
JMSF036I12Sequence585007098 (6)gb:AB015476_15126122e-07Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNC6.>gb:AY084399_15694534007098 (6)gb:AB015476_15126121e-07Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNC6.>gb:AY084399_15694

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF036I12+ CAGCATTCCGGATAGAGGGAAGAAAAAGAAGAAGAAGAAAGAAGA
JMSF004F09- ATCCAGCATTCCGGATAGAGGGAAGAAAAAGAAGAAGAAGAAAGAAGA
rJMSF004F11+ ATCCAGCATTCCGGATAGAGGGAAGAAAAAGAAGAAGAAGAAAGAAGA
rJMSF004F09+ ATCCAGCATTCCGGATAGAGGGAAGAAAAAGAAGAAGAAGAAAGAAGA
JMFN034N16- TCGGAAATCGGAATCCAGCATTCCGGATAGAGGGAAGAAAAAGAAGAAGAAGAAAGAAGA
JMSF036I12- CAGCATTCCGGATAGAGGGAAGAAAAAGAAGAAGAAGAAAGAAGA
                      ____________________________________________________________
consensus TCGGAAATCGGAATCCAGCATTCCGGATAGAGGGAAGAAAAAGAAGAAGAAGAAAGAAGA
 
. : . : . : . : . : . :
rJMSF036I12+ GAGCTAGCGATGATTGGATACGTAACGAAAGTACGTTTGACGTCGTTCTTCGCCGGCGCT
JMSF004F09- GAGCTAGCGATGATTGGATACGTAACGAAAGTACGTTTGACGTCGTTCTTCGCCGGCGCT
rJMSF004F11+ GAGCTAGCGATGATTGGATACGTAACGAAAGTACGTTTGACGTCGTTCTTCGCCGGCGCT
rJMSF004F09+ GAGCTAGCGATGATTGGATACGTAACGAAAGTACGTTNGACGTCGTTNTTCGCCGGCGCT
JMFN034N16- GAGCTAGCGATGATTGGATACGTAACGAAAGTACGTTTGACGTCGTTCTTCGCCGGCGCT
JMSF036I12- GAGCTAGCGATGATTGGATACGTAACGAAAGTACGTTTGACGTCGTTCTTCGCCGGCGCT
                      ____________________________________________________________
consensus GAGCTAGCGATGATTGGATACGTAACGAAAGTACGTTTGACGTCGTTCTTCGCCGGCGCT
 
. : . : . : . : . : . :
rJMSF036I12+ GCAACGGCGTCGTTCGCCGGCATCTACCTTCTTCATCAGGATTACAAGGTTTGCCACGAC
JMSF004F09- GCAACGGCGTCGTTCGCCGGCATCTACCTTCTTCATCAGGATTACAAGGTTTGCCACGAC
rJMSF004F11+ GCAACGGCGTCGTTCGCCGGCATCTACCTTCTTCATCAGGATTACAAGGTTTGCCACGAC
rJMSF004F09+ GCAACGGCGTCGTTCGCCGGCATCTACCTTCTTCATCAGGATTACAAGGTNTGCCACGAC
JMFN034N16- GCAACGGCGTCGTTCGCCGGCATCTACCTTCTTCATCAGGATTACAAGGTTTGCCACGAC
JMSF036I12- GCAACGGCGTCGTTCGCCGGCATCTACCTTCTTCATCAGGATTACAAGGTTTGCCACGAC
                      ____________________________________________________________
consensus GCAACGGCGTCGTTCGCCGGCATCTACCTTCTTCATCAGGATTACAAGGTTTGCCACGAC
 
. : . : . : . : . : . :
rJMSF036I12+ TCCATCGCTCAAGAGGTGAAAGGATTCCAAACATCACTTGATGATCGCATATCTGCTCTG
JMSF004F09- TCCATCGCTCAAGAGGTGAAAGGATTCCAAACATCACTTGATGATCGCATATCTGCTCTG
rJMSF004F11+ TCCATCGCTCAAGAGGTGAAAGGATTCCAAACATCACTTGATGATCGCATATCTGCTCTG
rJMSF004F09+ TCCATCGCTCAAGAGGTGAAAGGATTCCAAACATCACTTGATGATCGCATATCTGCTCTG
JMFN034N16- TCCATCGCTCAAGAGGTGAAAGGATTCCAAACATCACTTGATGATCGCATATCTGCTCTG
JMSF036I12- TCCATCGCTCAAGAGGTGAAAGGATTCCAAACATCACTTGATGATCGCATATCTGCTCTG
                      ____________________________________________________________
consensus TCCATCGCTCAAGAGGTGAAAGGATTCCAAACATCACTTGATGATCGCATATCTGCTCTG
 
. : . : . : . : . : . :
rJMSF036I12+ GAAAAACTGAAGGAGATTGAATCTGCAAAGCATTGAGCTGATTGAATAGATGATTGTATT
JMSF004F09- GAAAAACTGAAGGAGATTGAATCTGCAAAGCATTGAGCTGATTGAATAGATGATTGTATT
rJMSF004F11+ GAAAAACTGAAGGAGATTGAATCTGCAAAGCATTGAGCTGATTGAATAGATGATTGTATT
rJMSF004F09+ GAAAAACTGAAGGAGATTGAATCTGCAAAGCATTGAGCTGATTGAATAGATGATNGTATT
JMFN034N16- GAAAAACTGAAGGAGATTGAATCTGCAAAGCATTGAGCTGATTGAATAGATGATTGTATT
JMSF036I12- GAAAAACTGAAGGAGATTGAATCTGCAAAGCATTGAGCTGATTGAATAGATGATTGTATT
                      ____________________________________________________________
consensus GAAAAACTGAAGGAGATTGAATCTGCAAAGCATTGAGCTGATTGAATAGATGATTGTATT
 
. : . : . : . : . : . :
rJMSF036I12+ TCTGTGCTGCTGCTCTCTTGAGCTTTTTAGGGGTTAGATATCTTGGCTATAGTAAAAAAG
JMSF004F09- TCTGTGCTGCTGCTCTCTTGAGCTTTTTAGGGGTTAGATATCTTGGCTATAGTAAAAAAG
rJMSF004F11+ TCTGTGCTGCTGCTCTCTTGAGCTTTTTAGGGGTTAGATATCTTGGCTATAGTAAAAAAG
rJMSF004F09+ TCTGTGCTGCTGCTCTCTTGAGCTTTTTAGGGGTTAGATATCTTGGCTATAGTAAAAAAG
JMFN034N16- TCTGTGCTGCTGCTCTCTTGAGCTTTTTAGGGGTTAGATATCTTGGCTATAGTAAAAAAG
JMSF036I12- TCTGTGCTGCTGCTCTCTTGAGCTTTTTAGGGGTTAGATATCTTGGCTATAGTAAAAAAG
                      ____________________________________________________________
consensus TCTGTGCTGCTGCTCTCTTGAGCTTTTTAGGGGTTAGATATCTTGGCTATAGTAAAAAAG
 
. : . : . : . : . : . :
rJMSF036I12+ CTGATGCAACGGTGTGTGAAGATTTACTTGGCCAAAACTTCAATTCTTACTTCACTGCTT
JMSF004F09- CTGATGCAACGGTGTGTGAAGATTTACTTGGCCAAAACTTCAATTCTTACTTCACTGCTT
rJMSF004F11+ CTGATGCAACGGTGTGTGAAGATTTACTTGGCCAAAACTTCAATTCTTACTTCACTGCTT
rJMSF004F09+ CTGATGCAACGGTGTGTGAAGATTTACTTGGCCAAAACTTCAATTCTTACTTCACTGCTT
JMFN034N16- CTGATGCAACGGTGTGTGAAGATTTACTTGGCCAAAACTTCAATTCTTACTTCACTGCTT
JMSF036I12- CTGATGCAACGGTGTGTGAAGATTTACTTGGCCAAAACTTCAATTCTTACTTCACTGCTT
                      ____________________________________________________________
consensus CTGATGCAACGGTGTGTGAAGATTTACTTGGCCAAAACTTCAATTCTTACTTCACTGCTT
 
. : . : . : . : . : . :
rJMSF036I12+ CGGCTAAAGTCCATACTTTATTGGTATCCTGATTCCTGAGCTTTAACTC-TTCTAAAGAT
JMSF004F09- CGGCTAAAGTCCATACTTTATTGGTATCCTGATTCCTGAGCTTTAACTC-TTCTAAAGAT
rJMSF004F11+ CGGCTAAAGTCCATACTTTATTGGTATCCTGATTCCTGAGCTTTAACTCTTTCTAAAGAT
rJMSF004F09+ CGGCTAAAGTCCATACTTTATTGGTATCCTGATTCCTGAGCTTTAACTC-TTCTAAAGAT
JMFN034N16- CGGCTAAAGTCCATACTTTATTGGTATCCTGATTCCTGAGCTTTAACTC-TTCTAAAGAT
JMSF036I12- CGGCTAAAGTCCATACTTTATTGGTATCCTGATTCCTGAGCTTTAACTC-TTCTAAAGAT
                      ____________________________________________________________
consensus CGGCTAAAGTCCATACTTTATTGGTATCCTGATTCCTGAGCTTTAACTC-TTCTAAAGAT
 
. : . : . : . : . : . :
rJMSF036I12+ TTATTTATTACTCTATTGCTCTGTTGAGAATTACTTTGCTAAATTCCGATGAATTTTACC
JMSF004F09- TTATTT
rJMSF004F11+ TTATT
rJMSF004F09+ T
JMFN034N16- TTATTTATTACTCTATTGCTCTGTTGAGAATTACTTTGCTAAATTCCGATGAATTTTACC
JMSF036I12- TTATTTATTACTCTATTGCTCTGTTGAGAATTACTTTGCTAAATTCCGATGAATTTTACC
                      ____________________________________________________________
consensus TTATTTATTACTCTATTGCTCTGTTGAGAATTACTTTGCTAAATTCCGATGAATTTTACC
 
. : . : . : . : . : . :
rJMSF036I12+ ATCCAATTT
JMFN034N16- ATCCAATTTTGATGGTCACTCAATTTTTTATTACAATATTTTTAAT
JMSF036I12- ATCCAATTTTGATGGTCACTCAATTTTTTATTACAATATTTTTAATATTTAAAAAAAAAA
                      ____________________________________________________________
consensus ATCCAATTTTGATGGTCACTCAATTTTTTATTACAATATTTTTAATATTTAAAAAAAAAA