Previous Contig 007094:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF021M05Sequence610007094 (2)gb:AY085371_15704423e-21Arabidopsis thaliana clone 148254 mRNA, complete sequence.342010867 (4)
JMSF036H08Sequence616007094 (2)gb:AY085371_15704421e-20Arabidopsis thaliana clone 148254 mRNA, complete sequence.629013040 (22)sp|P46297|RS23_FRAAN1e-7540S ribosomal protein S23 (S12).>pir|S56673|S56673 ribosomal protein S23.e, cyto

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF021M05+ CTGCATTCTTGAA
JMSF036H08+ TTCCTGCATTCTTGAA
                      ____________________________________________________________
consensus TTCCTGCATTCTTGAA
 
. : . : . : . : . : . :
JMSF021M05+ TTCGCGGTTCTGTGTCTAGGCCGGAACCTGCACCTCTGTAGTTTCTGGCATATGGGGCGA
JMSF036H08+ TTCGCGGTTCTGTGTCTAGGCCGGAACCTGCACCTCTGTAGTTTCTGGCATATGGGGCGA
                      ____________________________________________________________
consensus TTCGCGGTTCTGTGTCTAGGCCGGAACCTGCACCTCTGTAGTTTCTGGCATATGGGGCGA
 
. : . : . : . : . : . :
JMSF021M05+ AGAAAGTCCAAGTATTTCTGGAAAAACTGCCTGGATAATCGTCGACAGCTTCTCAAGGAC
JMSF036H08+ AGAAAGTCCAAGTATTTCTGGAAAAACTGCCTGGATAATCGTCGACAGCTTCTCAAGGAC
                      ____________________________________________________________
consensus AGAAAGTCCAAGTATTTCTGGAAAAACTGCCTGGATAATCGTCGACAGCTTCTCAAGGAC
 
. : . : . : . : . : . :
JMSF021M05+ GGGCAGGGGATCCTCCCGGATGACTGCAGCATCTCGTTCTGGGCAACTGAAGTGGAAGGA
JMSF036H08+ GGGCAGGGGATCCTCCCGGATGACTGCAGCATCTCGTTCTGGGCAACTGAAGTGGAAGGA
                      ____________________________________________________________
consensus GGGCAGGGGATCCTCCCGGATGACTGCAGCATCTCGTTCTGGGCAACTGAAGTGGAAGGA
 
. : . : . : . : . : . :
JMSF021M05+ GTCGTTGGCATGGAGTCAGAAGCATCATACGCCTCCATGCTCATCGGCTTGAAGAAGAGA
JMSF036H08+ GTCGTTGGCATGGAGTCAGAAGCATCATACGCCTCCATGCTCATCGGCTTGAAGAAGAGA
                      ____________________________________________________________
consensus GTCGTTGGCATGGAGTCAGAAGCATCATACGCCTCCATGCTCATCGGCTTGAAGAAGAGA
 
. : . : . : . : . : . :
JMSF021M05+ GGCACGAGGAAGCCATTGGAAATGAGCTCGTCTGCATGCACAATCGCAAATGGAGAATCC
JMSF036H08+ GGCACGAGGAAGCCATTGGAAATGAGCTCGTCTGCATGCACAATCGCAAATGGAGAATCC
                      ____________________________________________________________
consensus GGCACGAGGAAGCCATTGGAAATGAGCTCGTCTGCATGCACAATCGCAAATGGAGAATCC
 
. : . : . : . : . : . :
JMSF021M05+ GAAATAGGGAGATCAAAGTTAAAATCCTGGGGAACGCTGAAGAATCTCTTCGAAGGGGAG
JMSF036H08+ GAAATAGGGAGATCAAAGTTAAAATCCTGGGGAACGCTGAAGAATCTCTTCGAAGGGGAG
                      ____________________________________________________________
consensus GAAATAGGGAGATCAAAGTTAAAATCCTGGGGAACGCTGAAGAATCTCTTCGAAGGGGAG
 
. : . : . : . : . : . :
JMSF021M05+ AGCTTCGGATCCATCTCGATGAAAGAAGAAGCCTCCTCATCAGAAAGAGAGGCCCTGAAG
JMSF036H08+ AGCTTCGGATCCATCTCGATGAAAGAAGAAGCCTCCTCATCAGAAAGAGAGGCCCTGAAG
                      ____________________________________________________________
consensus AGCTTCGGATCCATCTCGATGAAAGAAGAAGCCTCCTCATCAGAAAGAGAGGCCCTGAAG
 
. : . : . : . : . : . :
JMSF021M05+ GAGCTCTCCAGGCTCTCAAAAGATGGCTTCAGGTTCACCAGCCAACTGTAGGAAAAGCTA
JMSF036H08+ GAGCTCTCCAGGCTCTCAAAAGATGGCTTCAGGCTCACCAGCCAACTGTAGGAAAAGCTA
                      ____________________________________________________________
consensus GAGCTCTCCAGGCTCTCAAAAGATGGCTTCAGGTTCACCAGCCAACTGTAGGAAAAGCTA
 
. : . : . : . : . : . :
JMSF021M05+ TCAATGGAGAGAGACTGAGAGGTCTCCATAGGAGGGAGAAGGCTACAAAAAGTGGGAAGG
JMSF036H08+ TCAATGGAGAGAGACTGAGAGGTCTCCATAGGAGGGAGAAGGCTACAAAAAGTGGGAAGG
                      ____________________________________________________________
consensus TCAATGGAGAGAGACTGAGAGGTCTCCATAGGAGGGAGAAGGCTACAAAAAGTGGGAAGG
 
. : . : . : . : . : . :
JMSF021M05+ TTTACGCTACACACAGCATCAAAGCGCGGGGGTTCCTAAAGTAGTGAAATGGCCCTC
JMSF036H08+ TTTACGCTACACACAGCATCAAAGCGCGGGGGTTCCTAAAGTAGTGAAATGGCCCTCCCC
                      ____________________________________________________________
consensus TTTACGCTACACACAGCATCAAAGCGCGGGGGTTCCTAAAGTAGTGAAATGGCCCTCCCC