Previous Contig 007089:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN008L14Sequence606007089 (3)gb:AF436837_17998896e-77Arabidopsis thaliana At1g04870/F13M7_12 mRNA, complete cds.
JMSF003G20Sequence408007089 (3)gb:AF436837_17998892e-15Arabidopsis thaliana At1g04870/F13M7_12 mRNA, complete cds.811008238 (4)gb:AY058846_15643835e-56Arabidopsis thaliana At1g04870/F13M7_12 mRNA, complete cds.
JMSF036G07Sequence636007089 (3)gb:AF436837_17998891e-76Arabidopsis thaliana At1g04870/F13M7_12 mRNA, complete cds.733008238 (4)gb:AY058846_15643834e-49Arabidopsis thaliana At1g04870/F13M7_12 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN008L14+ GCTCCCCTACTGCAGACCGGATAGGTGCTACCCACATCCT
JMSF036G07+ CCCTACTGCAGACCGGATAGGTGCTACCCACATCCT
                      ____________________________________________________________
consensus GCTCCCCTACTGCAGACCGGATAGGTGCTACCCACATCCT
 
. : . : . : . : . : . :
JMFN008L14+ AGCATGGCTTGGGTACATAACTCCGTTTGGCTTCAGCCAGCGGTCACGGGCACAAATTAC
JMSF036G07+ AGCATGGCTTGGGTACATAACTCCGTTTGGCTTCAGCCAGCGGTCACGGGCACAAATTAC
                      ____________________________________________________________
consensus AGCATGGCTTGGGTACATAACTCCGTTTGGCTTCAGCCAGCGGTCACGGGCACAAATTAC
 
. : . : . : . : . : . :
JMFN008L14+ AGAATCAAACATTGACTCTCGAAGAAGAAAGTATCCCATCCATTCCGAAATAATCACATC
JMSF036G07+ AGAATCAAACATTGACTCTCGAAGAAGAAAGTATCCCATCCATTCCGAAATAATCACATC
                      ____________________________________________________________
consensus AGAATCAAACATTGACTCTCGAAGAAGAAAGTATCCCATCCATTCCGAAATAATCACATC
 
. : . : . : . : . : . :
JMFN008L14+ AACTTTCTCTGGCAGATTAACATCTTCAATAGAAGCCTCAATAACTTCAACAACTCCCTC
JMSF036G07+ AACTTTCTCTGGCAGATTAACATCTTCAATAGAAGCCTCAATAACTTCAACAACTCCCTC
                      ____________________________________________________________
consensus AACTTTCTCTGGCAGATTAACATCTTCAATAGAAGCCTCAATAACTTCAACAACTCCCTC
 
. : . : . : . : . : . :
JMFN008L14+ AAGGTTATTCGCCTTAACTAGTTCACGGGCATGATCTGCCATTTTGGTGGCTTCCACTGC
JMSF036G07+ AAGGTTATTCGCCTTAACTAGTTCACGGGCATGATCTGCCATTTTGGTGGCTTCCACTGC
                      ____________________________________________________________
consensus AAGGTTATTCGCCTTAACTAGTTCACGGGCATGATCTGCCATTTTGGTGGCTTCCACTGC
 
. : . : . : . : . : . :
JMFN008L14+ ATACACTTTTCTTGCACCAGCTTGCGCTGACCATATTGCTAGAATACCACTCCCAGTTCC
JMSF036G07+ ATACACTTTTCTTGCACCAGCTTGCGCTGACCATATTGCTAGAATACCACTCCCAGTTCC
                      ____________________________________________________________
consensus ATACACTTTTCTTGCACCAGCTTGCGCTGACCATATTGCTAGAATACCACTCCCAGTTCC
 
. : . : . : . : . : . :
JMSF003G20+ CCTTTCCGGCAAAGTGATGCTTGTTCTGGAAAACGGCGTTGTAATA
JMFN008L14+ TACATCCAATACAGCCTTTCCGGCAAAGTGATGCTTGTTCTGGAAAACGGCGTTGTAATA
JMSF036G07+ TACATCCAATACAGCCTTTCCGGCAAAGTGATGCTTGTTCTGGAAAACGGCGTTGTAATA
                      ____________________________________________________________
consensus TACATCCAATACAGCCTTTCCGGCAAAGTGATGCTTGTTCTGGAAAACGGCGTTGTAATA
 
. : . : . : . : . : . :
JMSF003G20+ AGAGTCCATGCGAACGCGGTCGGTGAGCATGTCCTTCTGATGGTAGAGAAAGGCGTAAGT
JMFN008L14+ AGAGTCCATGCGAACGCGGTCGGTGAGCATGTCCTTCTGATGGTAGAGAAAGGCGTAAGT
JMSF036G07+ AGAGTCCATGCGAACGCGGTCGGTGAGCATGTCCTTCTGATGGTAGAGAAAGGCGTAAGT
                      ____________________________________________________________
consensus AGAGTCCATGCGAACGCGGTCGGTGAGCATGTCCTTCTGATGGTAGAGAAAGGCGTAAGT
 
. : . : . : . : . : . :
JMSF003G20+ GCAGAAATAGTTGGCGAAATCGACGTCCTTGTCCACCGCAGCGGCGGCGCCGTCGCCGCG
JMFN008L14+ GCAGAAATAGTTGGCGAAATCGACGTCCTTGTCCACCGCAGCGGCGGCGCCGTCGCCGCG
JMSF036G07+ GCAGAAATAGTTGGCGAAATCGACGTCCTTGTCCACCGCAGCGGCGGCGCCGTCGCCGCG
                      ____________________________________________________________
consensus GCAGAAATAGTTGGCGAAATCGACGTCCTTGTCCACCGCAGCGGCGGCGCCGTCGCCGCG
 
. : . : . : . : . : . :
JMSF003G20+ GCTGATGGCGGCGGGCTGGATGCCATTCGATGAGCTCCCCATGTCAGCTAACCAAAGCAC
JMFN008L14+ GCTGATGGCGGCGGGCTGGATGCCATTCGATGAGCTCCCCATGTCAGCTAACCAAAGCAC
JMSF036G07+ GCTGATGGCGGCGGGCTGGATGCCATTCGATGAGCTCCCCATGTCAGCTAACCAAAGCAC
                      ____________________________________________________________
consensus GCTGATGGCGGCGGGCTGGATGCCATTCGATGAGCTCCCCATGTCAGCTAACCAAAGCAC
 
. : . : . : . : . : . :
JMFN008L14+ AACGCAGAGAGACAGGGAGAAGAAGA
JMSF036G07+ AACGCAGAGAGACAGGGAGAAGAAGAGAGTGTTTGATGTTTTAGGGCAGCGAATGAGTTC
                      ____________________________________________________________
consensus AACGCAGAGAGACAGGGAGAAGAAGAGAGTGTTTGATGTTTTAGGGCAGCGAATGAGTTC