Previous Contig 007086:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004C03Sequence444007086 (12)gb:AJ875407_18151152e-06Glycine max mRNA for N-rich protein (nrp gene).781007086 (12)sp|P37707|B2_DAUCA2e-79B2 protein.>pir|S32124|S32124 B2 protein - carrot>gb:DCB2P_1675650 D.carota mRNA
JMFF008L13Sequence536007086 (12)gb:AJ875407_18151153e-06Glycine max mRNA for N-rich protein (nrp gene).664007086 (12)sp|P37707|B2_DAUCA1e-70B2 protein.>pir|S32124|S32124 B2 protein - carrot>gb:DCB2P_1675650 D.carota mRNA
JMFF009N18Sequence555007086 (12)gb:AJ875407_18151153e-06Glycine max mRNA for N-rich protein (nrp gene).765007086 (12)sp|P37707|B2_DAUCA2e-79B2 protein.>pir|S32124|S32124 B2 protein - carrot>gb:DCB2P_1675650 D.carota mRNA
JMFF036G14Sequence597007086 (12)gb:AJ875407_18151153e-06Glycine max mRNA for N-rich protein (nrp gene).
JMFF050A22Sequence574007086 (12)gb:AJ875407_18151153e-06Glycine max mRNA for N-rich protein (nrp gene).
JMFN006P10Sequence601007086 (12)gb:AJ875407_18151153e-06Glycine max mRNA for N-rich protein (nrp gene).
JMFN007I15Sequence633007086 (12)gb:AJ875407_18151154e-06Glycine max mRNA for N-rich protein (nrp gene).
JMSF036F20Sequence591007086 (12)gb:AJ875407_18151154e-05Glycine max mRNA for N-rich protein (nrp gene).752007086 (12)sp|P37707|B2_DAUCA2e-79B2 protein.>pir|S32124|S32124 B2 protein - carrot>gb:DCB2P_1675650 D.carota mRNA

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF009N18- ATCATATAGTATATGTAATATGTACAAAAAACATCCTCAT
rJMFF004C03- GTACAAAAAACATCCTCAT
                      ____________________________________________________________
consensus ATCATATAGTATATGTAATATGTACAAAAAACATCCTCAT
 
. : . : . : . : . : . :
rJMFF009N18- TTGCTACGAGCAATCCATGAGATTACAACTACACTTTGTCTTTCTATTCCTAAACATCTT
rJMFF004C03- TTGCTACGAGCAATCCATGAGATTACAACTACACTTTGTCTTTCTATTCCTAAACATCTT
                      ____________________________________________________________
consensus TTGCTACGAGCAATCCATGAGATTACAACTACACTTTGTCTTTCTATTCCTAAACATCTT
 
. : . : . : . : . : . :
rJMFF009N18- CTTTTTCTCTTCTTCCTTCACACTTCTCTCCAGTCTATTGTCATTCGCATTATGCTCTGA
rJMFF004C03- CTTTTTCTCTTCTTCCTTCACACTTCTCTCCAGTTTATTGTCATTCGCATTATGCTCTGA
                      ____________________________________________________________
consensus CTTTTTCTCTTCTTCCTTCACACTTCTCTCCAGTTTATTGTCATTCGCATTATGCTCTGA
 
. : . : . : . : . : . :
rJMFF009N18- TACGGCTATGCCCGTTCAAGCGTTAGTCTCCGTGAAAGTGTCCAAAAGAGATAGCGTCTC
rJMSF036F20- TCTCCGTGAAAGTGTCCAAAAGAGATAGCGTCTC
rJMFF008L13- TCTCCGTGAAAGTGTCCAAAAGAGATAGCGTCTC
rJMFF004C03- TACGGCTATGCCCGTTCAAGCGTTAGTCTCCGTGAAAGTGTCCAAAAGAGATAGCGTCTC
                      ____________________________________________________________
consensus TACGGCTATGCCCGTTCAAGCGTTAGTCTCCGTGAAAGTGTCCAAAAGAGATAGCGTCTC
 
. : . : . : . : . : . :
rJMFF009N18- AGGAATGTTTAGCTCAAGGCGGAATTTAGGACCATCGTAGTGGTGAAGGATCGGCCTGAA
rJMSF036F20- AGGAATGTTTAGCTCAAGGCGGAATTTAGGACCATCGTAGTGGTGAAGGATCGGCCTGAA
rJMFF008L13- AGGAATGTTTAGCTCAAGGCGGAATTTAGGACCATCGTAGTGGTGAAGGATCGGCCTGAA
rJMFF004C03- AGGAATGTTTAGCTCAAGGCGGAATTTAGGACCATCGTAGTGGTGAAGGATCGGCCTGAA
                      ____________________________________________________________
consensus AGGAATGTTTAGCTCAAGGCGGAATTTAGGACCATCGTAGTGGTGAAGGATCGGCCTGAA
 
. : . : . : . : . : . :
rJMFF009N18- AGAATCCTCCTCGAGAGGTTCACACACTTTCCTCGTGACAACACGCACCTGAGCAGGAAA
rJMSF036F20- AGAATCCTCCTCGAGAGGTTCACACACTTTCCTCGTGACAACACGCACCTGAGCAGGAAA
rJMFF008L13- AGAATCCTCCTCGAGAGGTTCACACAC-TTCCTCGTGACAACACGCACCTGAGCAGGAAA
rJMFF004C03- AGAATCCTCCTCGAGAGGTTCACACACTTTCCTCGTGACAACACGCACCTGAGCAGGAAA
                      ____________________________________________________________
consensus AGAATCCTCCTCGAGAGGTTCACACACTTTCCTCGTGACAACACGCACCTGAGCAGGAAA
 
. : . : . : . : . : . :
rJMFF009N18- GCGTGATTCGCCTTGGTTCTTCTTGTCCTCCCAAGCTGTGGGATCAATGTTTGTGCCACC
rJMSF036F20- GCGTGATTCGCCTTGGTTCTTCTTGTCCTCCCAAGCTGTGGGATCAATGTTTGTGCCACC
rJMFF008L13- GCGTGATTCGCCTTGGTTCTTCTTGTCCTCCCAAGCTGTGGGATCAATGTTTGTGCCACC
rJMFF004C03- GCGTGATTCGCCTTGGTTCTTCTTGTCCTCCCAAGCTGTGGGATCAATGTTTGTGCCACC
                      ____________________________________________________________
consensus GCGTGATTCGCCTTGGTTCTTCTTGTCCTCCCAAGCTGTGGGATCAATGTTTGTGCCACC
 
. : . : . : . : . : . :
rJMFF009N18- AAAGCTTGCAGCCTCAAAAACTCCGTGAAGCTGGTGGGTCGAGTAGTTATAGAGGAAAAG
rJMSF036F20- AAAGCTTGCAGCCTCAAAAACTCCGTGAAGCTGGTGGGTCGAGTAGTTATAGAGGAAAAG
rJMFF008L13- AAAGCTTGCAGCCTCAAAAACTCCGTGAAGCTGGTGGGTCGAGTAGTTATAGAGGAAAAG
rJMFF004C03- AAAGCTTGCAGCCTCAAAAACTCCGTGAAGCTGGTGGGTCGAGTAGTTATAGAGGAAAAG
                      ____________________________________________________________
consensus AAAGCTTGCAGCCTCAAAAACTCCGTGAAGCTGGTGGGTCGAGTAGTTATAGAGGAAAAG
 
. : . : . : . : . : . :
rJMFF009N18- AGGCAATCCGGGTGTGATTTGCCTGACTGAGTCACGATAACGAGCTGGCAAGCCAAAGAG
rJMSF036F20- AGGCAATCCGGGTGTGATTTGCCTGACTGAGTCACGATAACGAGCTGGCAAGCCAAAGAG
rJMFF008L13- AGGCAATCCGGGTGTGATTTGCCTGACTGAGTCACGATAACGAGCTGGCAAGCCAAAGAG
rJMFF004C03- AGGCAATCCGGGTGTGATTTGCCTGACTGAGTCACGATAACGAGCTGGCAAGCCAAAGAG
                      ____________________________________________________________
consensus AGGCAATCCGGGTGTGATTTGCCTGACTGAGTCACGATAACGAGCTGGCAAGCCAAAGAG
 
. : . : . : . : . : . :
rJMFF009N18- CTGTCTTTTGAGATTTTCTTGCATGGTATCATTGTTGCAGACAAAGATGTAGCCTCCGAC
rJMSF036F20- CTGTCTTTTGAGATTTTCTTGCATGGTATCATTGTTGCAGACAAAGATGTAGCCTCCGAC
rJMFF008L13- CTGTCTTTTGAGATTTTCTTGCATGGTATCATTGTTGCAGACAAAGATGTAGCCTCCGAC
rJMFF004C03- CTGTCTTTTGAGATTTTCTTGCATGGTATCATTGTTGCAGACAAAGATGTAGCCTCCGAC
                      ____________________________________________________________
consensus CTGTCTTTTGAGATTTTCTTGCATGGTATCATTGTTGCAGACAAAGATGTAGCCTCCGAC
 
. : . : . : . : . : . :
rJMFF009N18- AGTCTCGTTTCTGGGCAGGGCTTCTGCGGGTGGAAGAGTCTTGAACCTCTTATCCACTGC
rJMSF036F20- AGTCTCGTTTCTGGGCAGGGCTTCTGCGGGTGGAAGAGTCTTGAACCTCTTATCCACTGC
rJMFF008L13- AGTCTCGTTTCTGGGCAGGGCTTCTGCGGG
rJMFF004C03- AGTCTCGTTTCTGGGCAGGGCTTCTGCGGGTGGAAGAGTCTTGAACCTCTTATCCACTGC
JMFN007I15+ ACTGC
                      ____________________________________________________________
consensus AGTCTCGTTTCTGGGCAGGGCTTCTGCGGGTGGAAGAGTCTTGAACCTCTTATCCACTGC
 
. : . : . : . : . : . :
rJMFF009N18- ATTATTTTTGTCTCCATTATTGTTGTTATTGTTATCCTTGNTAACGTTTTTGTTCTTTTT
rJMSF036F20- ATTATTTTTGTCTCCATTATTGTTGTTATTGTTATCCTTGTTAACGTTTTTGTTCTTTTT
rJMFF004C03- ATTATTTTTGTCTCCATTATTGTTGTTATTGTTATCCTTGTTAACGTTTTTNTTCTTTTT
JMFN006P10+ TTTTGTCTCCATTATTGTGGTTATTGTTATCCTTGTTAACGTTTTTG-TCTTTTT
JMFN007I15+ ATTATTNTTGTCTCCATATTGGTTGTTATTGTTATCCTTGTTAACGTTTTTGTTCTTTTT
JMFF036G14+ TTCTTTTT
                      ____________________________________________________________
consensus ATTATTTTTGTCTCCATTATTGTTGTTATTGTTATCCTTGTTAACGTTTTTGTTCTTTTT
 
. : . : . : . : . : . :
rJMFF009N18- TCCAGATTTCCCATGTCCATATGCATGCTCCTCGTCAAATCCGAACTTCCCAAGTTTCTT
rJMSF036F20- TCCAGATTTCCCATGTCCATATGCATGCTCCTCGTCAAATCNGAAC
rJMFF004C03- TCCAGATTTCCCATGTCCATATGCATGCTCCTCGTCAAATCCGAACTTCCC-AGTTTCTT
JMFN006P10+ TCCAGATTTCCCATGTCCATATGCATGCTCCTCGTCAAATCCGAACTTCCCAAGTTTCTT
JMFN007I15+ TCCAGATTTCCCATGTCCATATGCATGCTCCTCGTCAAATCCGAACTTCCCAAGTTTCTT
JMFF050A22+ TGTCCATATGCATGCTCCTCGTCAAATCCGAACTTCCCAAGTTTCTT
JMFF009N18+ CGTCAAATCCGAACTTCCCAAGTTTCTT
JMFF036G14+ TCCAGATTTCCCATGTCCATATGCATGCTCCTCGTCAAATCCGAACTTCCCAAGTTTCTT
JMFF008L13+ CTT
JMSF036F20+ CCCATGTCCATATGCATGCTCCTCGTCAAATCCGAACTTCCCAAGTTTCTT
                      ____________________________________________________________
consensus TCCAGATTTCCCATGTCCATATGCATGCTCCTCGTCAAATCCGAACTTCCCAAGTTTCTT
 
. : . : . : . : . : . :
rJMFF009N18- G
rJMFF004C03- GTTCATGTTAAAGTTAACCCCTTT
JMFN006P10+ GTTCATGTTAAAGTTAACCCCTTTGCCATTCACCGCCACATTGTTACTCCCTTTACTGTA
JMFN007I15+ GTTCATGTTAAAGTTAACCCCTTTGCCATTCACCGCCACATTGTTACTCCCTTTACTGTA
JMFF050A22+ GTTCATGTTAAAGTTAACCCCTTTGCCATTCACCGCCACATTGTTACTCCCTTTACTGTA
JMFF009N18+ GTTCATGTTAAAGTTAACCCCTTTGCCATTCACCGCCACATTGTTACTCCCTTTACTGTA
JMFF036G14+ GTTCATGTTAAAGTTAACCCCTTTGCCATTCACCGCCACATTGTTACTCCCTTTACTGTA
JMFF008L13+ GTTCATGTTAAAGTTAACCCCTTTGCCATTCACCGCCACATTGTTACTCCCTTTACTGTA
JMSF036F20+ GTTCATGTTAAAGTTAACCCCTTTGCCATTCACCGCCACATTGTTACTCCCTTTACTGTA
                      ____________________________________________________________
consensus GTTCATGTTAAAGTTAACCCCTTTGCCATTCACCGCCACATTGTTACTCCCTTTACTGTA
 
. : . : . : . : . : . :
JMFN006P10+ GGAATTGAAGTTCATCGCCGCCGGGGTGGGATAAATCCCCTTGTTAAACCCGCCGTTCAA
JMFN007I15+ GGAATTGAAGTTCATCGCCGCCGGGGTGGGATAAATCCCCTTGTTAAACCCGCCGTTCAA
JMFF050A22+ GGAATTGAAGTTCATCGCCGCCGGGGTGGGATAAATCCCCTTGTTAAACCCGCCGTTCAA
JMFF009N18+ GGAATTGAAGTTCATCGCCGCCGGGGTGGGATAAATCCCCTTGTTAAACCCGCCGTTCAA
JMFF036G14+ GGAATTGAAGTTCATCGCCGCCGGGGTGGGATAAATCCCCTTGTTAAACCCGCCGTTCAA
JMFF004C03+ GCCGGGGTGGGATAAATCCCCTTGTTAAACCCGCCGTTCAA
JMFF008L13+ GGAATTGAAGTTCATCGCCGCCGGGGTGGGATAAATCCCCTTGTTAAACCCGCCGTTCAA
JMSF036F20+ GGAATTGAAGTTCATCGCCGCCGGGGTGGGATAAATCCCCTTGTTAAACCCGCCGTTCAA
                      ____________________________________________________________
consensus GGAATTGAAGTTCATCGCCGCCGGGGTGGGATAAATCCCCTTGTTAAACCCGCCGTTCAA
 
. : . : . : . : . : . :
JMFN006P10+ CCCCACTCCGAACACCCCCTTCGCCGCCGACGACCCGGAAATCGAGCTGATCTCGTCGGA
JMFN007I15+ CCCCACTCCGAACACCCCCTTCGCCGCCGACGACCCGGAAATCGAGCTGATCTCGTCGGA
JMFF050A22+ CCCCACTCCGAACACCCCCTTCGCCGCCGACGACCCGGAAATCGAGCTGATCTCGTCGGA
JMFF009N18+ CCCCACTCCGAACACCCCCTTCGCCGCCGACGACCCGGAAATCGAGCTGATCTCGTCGGA
JMFF036G14+ CCCCACTCCGAACACCCCCTTCGCCGCCGACGACCCGGAAATCGAGCTGATCTCGTCGGA
JMFF004C03+ CCCCACTCCGAACACCCCCTTCGCCGCCGACGACCCGGAAATCGAGCTGATCTCGTCGGA
JMFF008L13+ CCCCACTCCGAACACCCCCTTCGCCGCCGACGACCCGGAAATCGAGCTGATCTCGTCGGA
JMSF036F20+ CCCCACTCCGAACACCCCCTTCGCCGCCGACGACCCGGAAATCGAGCTGATCTCGTCGGA
                      ____________________________________________________________
consensus CCCCACTCCGAACACCCCCTTCGCCGCCGACGACCCGGAAATCGAGCTGATCTCGTCGGA
 
. : . : . : . : . : . :
JMFN006P10+ GACCTTCCACCCATCATTACTGAACAGATTATAATTGGATTTGAAATTATTGACCTGGTT
JMFN007I15+ GACCTTCCACCCATCATTACTGAACAGATTATAATTGGATTTGAAATTATTGACCTGGTT
JMFF050A22+ GACCTTCCACCCATCATTACTGAACAGATTATAATTGGATTTGAAATTATTGACCTGGTT
JMFF009N18+ GACCTTCCACCCATCATTACTGAACAGATTATAATTGGATTTGAAATTATTGACCTGGTT
JMFF036G14+ GACCTTCCACCCATCATTACTGAACAGATTATAATTGGATTTGAAATTATTGACCTGGTT
JMFF004C03+ GACCTTCCACCCATCATTACTGAACAGATTATAATTGGATTTGAAATTATTGACCTGGTT
JMFF008L13+ GACCTTCCACCCATCATTACTGAACAGATTATAATTGGATTTGAAATTATTGACCTGGTT
JMSF036F20+ GACCTTCCACCCATCATTACTGAACAGATTATAATTGGATTTGAAATTATTGACCTGGTT
                      ____________________________________________________________
consensus GACCTTCCACCCATCATTACTGAACAGATTATAATTGGATTTGAAATTATTGACCTGGTT
 
. : . : . : . : . : . :
JMFN006P10+ ATTGGTCGCCGTCGCCGTCGCCGCGGCGAGGGCGGCGTTGTCGTTGACTGAATTGACCTC
JMFN007I15+ ATTGGTCGCCGTCGCCGTCGCCGCGGCGAGGGCGGCGTTGTCGTTGACTGAATTGACCTC
JMFF050A22+ ATTGGTCGCCGTCGCCGTCGCCGCGGCGAGGGCGGCGTTGTCGTTGACTGAATTGACCTC
JMFF009N18+ ATTGGTCGCCGTCGCCGTCGCCGCGGCGAGGGCGGCGTTGTCGTTGACTGAATTGACCTC
JMFF036G14+ ATTGGTCGCCGTCGCCGTCGCCGCGGCGAGGGCGGCGTTGTCGTTGACTGAATTGACCTC
JMFF004C03+ ATTGGTCGCCGTCGCCGTCGCCGCGGCGAGGGCGGCGTTGTCGTTGACTGAATTGACCTC
JMFF008L13+ ATTGGTCGCCGTCGCCGTCGCCGCGGCGAGGGCGGCGTTGTCGTTGACTGAATTGACCTC
JMSF036F20+ ATTGGTCGCCGTCGCCGTCGCCGCGGCGAGGGCGGCGTTGTCGTTGACTGAATTGACCTC
                      ____________________________________________________________
consensus ATTGGTCGCCGTCGCCGTCGCCGCGGCGAGGGCGGCGTTGTCGTTGACTGAATTGACCTC
 
. : . : . : . : . : . :
JMFN006P10+ GAAGTTCCGCCTCTCCTCCGGCCGCTTGGACCCGTAGCTAGTACTCCAAATGGAATCGTT
JMFN007I15+ GAAGTTCCGCCTCTCCTCCGGCCGCTTGGACCCGTAGCTAGTACTCCAAATGGAATCGTT
JMFF050A22+ GAAGTTCCGCCTCTCCTCCGGCCGCTTGGACCCGTAGCTAGTACTCCAAATGGAATCGTT
JMFF009N18+ GAAGTTCCGCCTCTCCTCCGGCCGCTTGGACCCGTAGCTAGTACTCCAAATGGAATCGTT
JMFF036G14+ GAAGTTCCGCCTCTCCTCCGGCCGCTTGGACCCGTAGCTAGTACTCCAAATGGAATCGTT
JMFF004C03+ GAAGTTCCGCCTCTCCTCCGGCCGCTTGGACCCGTAGCTAGTACTCCAAATGGAATCGTT
JMFF008L13+ GAAGTTCCGCCTCTCCTCCGGCCGCTTGGACCCGTAGCTAGTACTCCAAATGGAATCGTT
JMSF036F20+ GAAGTTCCGCCTCTCCTCCGGCCGCTTGGACCCGCAGCTAGTACTCCAAATGGAATCGTT
                      ____________________________________________________________
consensus GAAGTTCCGCCTCTCCTCCGGCCGCTTGGACCCGTAGCTAGTACTCCAAATGGAATCGTT
 
. : . : . : . : . : . :
JMFN006P10+ GAGGGACAGATTCGCCAGGCTGTTGGCCTGCAGACGGAGCTCGTCGCTGAACTGCCAGAA
JMFN007I15+ GAGGGACAGATTCGCCAGGCTGTTGGCCTGCAGACGGAGCTCGTCGCTGAACTGCCAGAA
JMFF050A22+ GAGGGACAGATTCGCCAGGCTGTTGGCCTGCAGACGGAGCTCGTCGCTGAACTGCCAGAA
JMFF009N18+ GAGGGACAGATTCGCCAGGCTGTTGGCCTGCAGACGGAGCTCGTCGCTGAACTGCCAGAA
JMFF036G14+ GAGGGACAGATTCGCCAGGCTGTTGGCCTGCAGACGGAGCTCGTCGCTGAACTGCCAGAA
JMFF004C03+ GAGGGACAGATTCGCCAGGCTGTTGGCCTGCAGACGGAGCTCGTCGCTGAACTGCCAGAA
JMFF008L13+ GAGGGACAGATTCGCCAGGCTGTTGGCCTGCAGACGGAGCTCGTCGCTGAACTGCCAGAA
JMSF036F20+ GAGGGACAGATTCGCCAGGCTGTTGGCCTGCAGACGGAGCTCGTCGCTGAACTGCCAGAA
                      ____________________________________________________________
consensus GAGGGACAGATTCGCCAGGCTGTTGGCCTGCAGACGGAGCTCGTCGCTGAACTGCCAGAA
 
. : . : . : . : . : . :
JMFN006P10+ AGACGACTGCGTGTTCTCCATTTCTTTTCCTCTGTTGAACTCGCCGGAAAATCAAGAAAA
JMFN007I15+ AGACGACTGCGTGTTCTCCATTTCTTTTCCTCTGTTGAACTCGCCGGAAAATCAAGAAAA
JMFF050A22+ AGACGACTGCGTGTTCTCCATTTCTTTTCCTCTGTTGAACTCGCCGGAAAATCAAGAAAA
JMFF009N18+ AGACGACTGCGTGTTCTCCATTTCTTTTCCTCTGTTGAACTCGCCGGAAAATCAAGAAAA
JMFF036G14+ AGACGACTGCGTGTTCTCCATTTCTTTTCCTCTGTTGAACTCGCCGGAAAATCAAGAAAA
JMFF004C03+ AGACGACTGCGTGTTCTCCATTTCTTTTCCTCTGTTGAACTCGCCGGAAAATCAAGAAAA
JMFF008L13+ AGACGACTGCGTGTTCTCCATTTCTTTTCCTCTGTTGAACTCGCCGGAAAATCAAGAAAA
JMSF036F20+ AGACGACTGCGTGTTCTCCATTTCTTTTCCTCTGTTGAACTCGCCGGAAAATCAAGAAAA
                      ____________________________________________________________
consensus AGACGACTGCGTGTTCTCCATTTCTTTTCCTCTGTTGAACTCGCCGGAAAATCAAGAAAA
 
. : . : . : . : . : . :
JMFN007I15+ CGCCTAAAGATTGAATTTTTATTTTTAA
JMFF050A22+ CGCCTAAAGATTGAATTTTTATTTTTAATGTGGAAATTAAACCA
JMFF009N18+ CGCCTAAAGATTGAATTTTTATTTTTAATGTGGAAATTAAACCA
JMFF036G14+ CGCCTAAAGATTGAATTTTTATTTTTAATGTGGAAATTAAACCA
JMFF004C03+ CGCCTAAAGATTGAATTTTTATTTTTAATGTGGAAATTAAACC
JMFF008L13+ CGCCTAAAGATTGAATTTTTATTTTTAATGTGGAAATTAAACCA
JMSF036F20+ CGCCTAAAGATTGAATTTTTATTTTTAATGTGGAAATTAAACCAACTATAAATGAAGATC
                      ____________________________________________________________
consensus CGCCTAAAGATTGAATTTTTATTTTTAATGTGGAAATTAAACCAACTATAAATGAAGATC