Previous Contig 007074:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF036B19Sequence674007074 (2)pir|T52407|T524075e-24RING-H2 zinc finger protein ATL4 [imported] - Arabidopsis thaliana>gb:AF132014_1644013042 (2)gb:AF079184_17663062e-22Arabidopsis thaliana RING-H2 finger protein RHX1a mRNA, partial cds.
JMSF036I01Sequence673007074 (2)pir|T52407|T524074e-24RING-H2 zinc finger protein ATL4 [imported] - Arabidopsis thaliana>gb:AF132014_1531013042 (2)gb:AF079184_17663066e-22Arabidopsis thaliana RING-H2 finger protein RHX1a mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF036I01+ GGATACACCG
JMSF036B19+ CGTGGGATACACCG
                      ____________________________________________________________
consensus CGTGGGATACACCG
 
. : . : . : . : . : . :
JMSF036I01+ TAGAGCGGCACAGAGGACAAGTCTGATTGGTGGAGAGCCACGAGTCGATACACTGCGCGT
JMSF036B19+ TAGAGCGGCACAGAGGACAAGTCTGATTGGTGGAGAGCCACGAGTCGATACACTGCGCGT
                      ____________________________________________________________
consensus TAGAGCGGCACAGAGGACAAGTCTGATTGGTGGAGAGCCACGAGTCGATACACTGCGCGT
 
. : . : . : . : . : . :
JMSF036I01+ GGAACGCGTGGCAACACAGAGGCAATAACCGCAACTGATCATGCGTCTCAAATTTGGACA
JMSF036B19+ GGAACGCGTGGCAACACAGAGGCAATAACCGCAACTGATCATGCGTCTCAAATTTGGACA
                      ____________________________________________________________
consensus GGAACGCGTGGCAACACAGAGGCAATAACCGCAACTGATCATGCGTCTCAAATTTGGACA
 
. : . : . : . : . : . :
JMSF036I01+ AACAAACCGCACAGTCCACGCCGGTAAGGTTCCCCGTAACAGAGCCAAACGTAAACAGCG
JMSF036B19+ AACAAACCGCACAGTCCACGCCGGTAAGGTTCCCCGTAACAGAGCCAAACGTAAACAGCG
                      ____________________________________________________________
consensus AACAAACCGCACAGTCCACGCCGGTAAGGTTCCCCGTAACAGAGCCAAACGTAAACAGCG
 
. : . : . : . : . : . :
JMSF036I01+ GCAGCGACTCCAACGTCTCGGGAGAAGAGCGCCGCTCGTTCGCGGCTGCTGCTGTGGCCG
JMSF036B19+ GCAGCGACTCCAACGTCTCGGGAGAAGAGCGCCGCTCGTTCGCGGCTGCTGCTGTGGCCG
                      ____________________________________________________________
consensus GCAGCGACTCCAACGTCTCGGGAGAAGAGCGCCGCTCGTTCGCGGCTGCTGCTGTGGCCG
 
. : . : . : . : . : . :
JMSF036I01+ CGGCGGCGGCTGCGGAGCTAGAGATCACGTCGTCCGCCGCGTCGTGCGTCCGAAACGAGC
JMSF036B19+ CGGCGGCGGCTGCGGAGCTAGAGATCACGTCGTCCGCCGCGTCGTGCGTCCGAAACGAGC
                      ____________________________________________________________
consensus CGGCGGCGGCTGCGGAGCTAGAGATCACGTCGTCCGCCGCGTCGTGCGTCCGAAACGAGC
 
. : . : . : . : . : . :
JMSF036I01+ GGTGGCAGCGGCGAGACAGCAAGCGGAGGATGAGGTAAATAGTGGCGGAGACGATAACCG
JMSF036B19+ GGTGGCAGCGGCGAGACAGCAAGCGGAGGATGAGGTAAATAGTGGCGGAGACGATAACCG
                      ____________________________________________________________
consensus GGTGGCAGCGGCGAGACAGCAAGCGGAGGATGAGGTAAATAGTGGCGGAGACGATAACCG
 
. : . : . : . : . : . :
JMSF036I01+ CGGACGCGATAACAATAACAACGATAATAATCGACGACGAAGGCGAGGATGAGGACGACG
JMSF036B19+ CGGACGCGATAACAATAACAACGATAATAATCGACGACGAAGGCGAGGATGAGGACGACG
                      ____________________________________________________________
consensus CGGACGCGATAACAATAACAACGATAATAATCGACGACGAAGGCGAGGATGAGGACGACG
 
. : . : . : . : . : . :
JMSF036I01+ ACGAAGAAGAAGCCGCAGGCGGTGGATCACCAGGCTGTTGAGGTTGGAACAGGTTATTAG
JMSF036B19+ ACGAAGAAGAAGCCGCAGGCGGTGGATCACCAGGCTGTTGAGGTTGGAACAGGTTATTAG
                      ____________________________________________________________
consensus ACGAAGAAGAAGCCGCAGGCGGTGGATCACCAGGCTGTTGAGGTTGGAACAGGTTATTAG
 
. : . : . : . : . : . :
JMSF036I01+ CCGAAGGAAGTGAAGCACCACCACCACCACCACCGCCACCGTTGATGGTGGGGAAGAACG
JMSF036B19+ CCGAAGGAAGTGAAGCACCACCACCACCACCACCGCCACCGTTGATGGTGGGGAAGAACG
                      ____________________________________________________________
consensus CCGAAGGAAGTGAAGCACCACCACCACCACCACCGCCACCGTTGATGGTGGGGAAGAACG
 
. : . : . : . : . : . :
JMSF036I01+ GCGGCGGTAAGTATACGCCGGACATTGTAGAGAGAGAGAGAGAAAGTGAAGGAAATAATG
JMSF036B19+ GCGGCGGTAAGTATACGCCGGACATTGTAGAGAGAGAGAGAGAAAGTGAAGGAAATAATG
                      ____________________________________________________________
consensus GCGGCGGTAAGTATACGCCGGACATTGTAGAGAGAGAGAGAGAAAGTGAAGGAAATAATG
 
. : . : . : . : . : . :
JMSF036I01+ GAGGAAGAGAGAGAGGGGGAGAGATTAGGCGCCTGTAGAGAGAGAAAGTGTGGGGGTTTC
JMSF036B19+ GAGGAAGAGAGAGAGGGGGAGAGATTAGGCGCCTGTAGAGAGAGAAAGTGTGGGGGTTTC
                      ____________________________________________________________
consensus GAGGAAGAGAGAGAGGGGGAGAGATTAGGCGCCTGTAGAGAGAGAAAGTGTGGGGGTTTC