Previous Contig 007071:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF042D06Sequence636007071 (6)gb:AX641830_14714655e-11Sequence 1 from Patent WO02097101.
JMSF008P19Sequence262007071 (6)723022299
JMSF036B15Sequence560007071 (6)gb:AX641830_14714656e-09Sequence 1 from Patent WO02097101.706007071 (6)gb:AX641830_14714656e-11Sequence 1 from Patent WO02097101.
JMSF044C07Sequence911007071 (6)gb:AX641830_14714655e-09Sequence 1 from Patent WO02097101.672024078
JMSF053E23Sequence387007071 (6)315024540

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF008P19+ GGAACATCTGAATGC
rJMSF036B15- CTTGGACGATAATAATATTGGAACATCTGAATGC
                      ____________________________________________________________
consensus CTTGGACGATAATAATATTGGAACATCTGAATGC
 
. : . : . : . : . : . :
JMSF008P19+ ATACGCTTTCAGGAAAAGAGAAAGATATGCCAGAATCTCAGCTCCAATTCATTATCGGCA
rJMSF036B15- ATACGCTTTCAGGAAAAGAGAAAGATATGCCAGAATCTCAGCTCCAATTCATTATCGGCA
                      ____________________________________________________________
consensus ATACGCTTTCAGGAAAAGAGAAAGATATGCCAGAATCTCAGCTCCAATTCATTATCGGCA
 
. : . : . : . : . : . :
JMSF008P19+ ACGTACAGCGCTGAAAACGCCATGGACAATGCGCATCAGAGACTCTAATTTATTGCCTT
rJMSF036B15- ACGTACAGCGCTGAAAACGCCATGGACAATGCGCATCAGAGACTCTAATTTATTGCCTTC
                      ____________________________________________________________
consensus ACGTACAGCGCTGAAAACGCCATGGACAATGCGCATCAGAGACTCTAATTTATTGCCTTC
 
. : . : . : . : . : . :
rJMSF036B15- AAGGAACCGAATGACAAAAAAATAGAACTCAAAATACTTGGGCAAATTTATGCGTGTCGG
                      ____________________________________________________________
consensus AAGGAACCGAATGACAAAAAAATAGAACTCAAAATACTTGGGCAAATTTATGCGTGTCGG
 
. : . : . : . : . : . :
rJMSF036B15- AACGTCTGAATGCATACACTTTCTGGAAAACAGAAAGATACGCTAGAATCTCAGCTCCGA
                      ____________________________________________________________
consensus AACGTCTGAATGCATACACTTTCTGGAAAACAGAAAGATACGCTAGAATCTCAGCTCCGA
 
. : . : . : . : . : . :
rJMSF036B15- TTCATTATCGGCAACGTACAGCGGCTTAACGGTAAAAGAAAGGAATGCCAGAATCTCAGC
JMSF044C07+ GCTTAACGGTAAAAGAAAGGAATGCCAGAATCTCAGC
                      ____________________________________________________________
consensus TTCATTATCGGCAACGTACAGCGGCTTAACGGTAAAAGAAAGGAATGCCAGAATCTCAGC
 
. : . : . : . : . : . :
rJMSF036B15- TCCATTTCATTATCGGCAACGTACAGCGCTGAAAACGCCATGGACAAAGCGCATCAGAGA
JMFF042D06+ GCAACGTACAGCGCTGAAAACGCCATGGACAAAGCGCATCAGAGA
JMSF044C07+ TCCATTTCATTATCGGCAACGTACAGCGCTGAAAACGCCATGGACAAAGCGCATCAGAGA
                      ____________________________________________________________
consensus TCCATTTCATTATCGGCAACGTACAGCGCTGAAAACGCCATGGACAAAGCGCATCAGAGA
 
. : . : . : . : . : . :
rJMSF036B15- CTCTAATTTATTGCCTTACCAACAGCAAAACTTCATCCCACATCAACCCCTAAAAACAAT
JMFF042D06+ CTCTAATTTATTGCCTTACCAACAGCAAAACTTCATCCCACATCAACCCCTAAAAACAAT
JMSF044C07+ CTTTAATTTATTGCCTTACCAACAGCAAAACTTCATCCCACATCNACCCCTAAAAACAAT
JMSF036B15+ CATCAACCCCTAAAAACAAT
                      ____________________________________________________________
consensus CTCTAATTTATTGCCTTACCAACAGCAAAACTTCATCCCACATCAACCCCTAAAAACAAT
 
. : . : . : . : . : . :
rJMSF036B15- AGCTAACGAAAACGCTAGAATGGGAGTAAATTGCAGATCGCCGGTGGCGATGTGCAGGCC
JMFF042D06+ AGCTAACGAAAACGCTAGAATGGGAGTAAATTGCAGATCGCCGGTGGCGATGTGCAGGCC
JMSF044C07+ AGCTAACGAAAACGCTAGAATGGGAGTAAATTGCAGATCNCCGGTGGCGATGTGCAGGCC
JMSF036B15+ AGCTAACGAAAACGCTAGAATGGGAGTAAATTGCAGATCGCCGGTGGCGATGTGCNGGCC
                      ____________________________________________________________
consensus AGCTAACGAAAACGCTAGAATGGGAGTAAATTGCAGATCGCCGGTGGCGATGTGCAGGCC
 
. : . : . : . : . : . :
rJMSF036B15- TCCGAAGAGTGTAGAAAGTCGGCAAGCGTAAATCCCCTTTCGGACGCCGGGGAATCCTAA
JMFF042D06+ TCCGAAGAGTGTAGAAAGTCGGCAAGCGTAAATCCCCTTTCGGACGCCGGGGAATCCTAA
JMSF044C07+ TCCGAAGAGTGTAGAAAGTCGGCAAGCGTAAATCCCCTTTCGGACGCCGGGGAATCCTAA
JMSF036B15+ TCCGAAGAGTGTAGAAAGTCGGCAAGCGTAAATCCCCTTTCGGACGCCGGGGAATCCTAA
                      ____________________________________________________________
consensus TCCGAAGAGTGTAGAAAGTCGGCAAGCGTAAATCCCCTTTCGGACGCCGGGGAATCCTAA
 
. : . : . : . : . : . :
rJMSF036B15- GAACACCAATTGGGCGCTCTTAGCCTTTAGATCTTGACCCGTCGAGAGAGGATTATTGAT
JMFF042D06+ GAACACCAATTGGGCGCTCTTAGCCTTTAGATCTTGACCCGTCGAGAGAGGATTATTGAT
JMSF053E23+ TTGACCCGTCGAGAGAGGATTATTGAT
JMSF044C07+ GAACNCCAATTGGGCGCTNTTAGCCTTTAGATCTTGACCCGTCGAGAGAGGATTATTGAT
JMSF036B15+ GAACNCCAATTGGGCGCTNTTAGCCTTTAGATCTTGACCCGTCGAGAGAGGATTATTGAT
                      ____________________________________________________________
consensus GAACACCAATTGGGCGCTCTTAGCCTTTAGATCTTGACCCGTCGAGAGAGGATTATTGAT
 
. : . : . : . : . : . :
rJMSF036B15- GCACGGATGCGATTTCACTGTCTCCNATGCAGCGGCAGCGGATAAAGAGCTCC-AAGCGA
JMFF042D06+ GCACGGATGCGATTTCACTGTCTCCAATGCAGCGGCAGCGGATAAAGAGCTCCAAAGCGA
JMSF053E23+ GCACGGATGCGATTTCACTGTNTCCAATGCAGCGGCAGCGGATAAAGAGCTCCAAAGNGN
JMSF044C07+ GCNCGGATGCGATTTCNCTGTCTCCAATGCAGCGGCAGCGGATAAAGAGCTCCAAAGCGA
JMSF036B15+ GCNCGGATGCGATTTCNCTGTNTCCAATGCAGCGGCAGCGGATAAAGAGCTCCAAAGCGA
                      ____________________________________________________________
consensus GCACGGATGCGATTTCACTGTCTCCAATGCAGCGGCAGCGGATAAAGAGCTCCAAAGCGA
 
. : . : . : . : . : . :
rJMSF036B15- TGAGAATGAGGAT
JMFF042D06+ TGAGAATGAGGATAAGTAGGGAAGAAATTTTTGAACATCAAAATCTACAGGAGACTATTT
JMSF053E23+ TGNGAATGAGGNTAAGTAGGGAAGAAATTTTTGAACNTCAAAATNTACNGGNGACTATTT
JMSF044C07+ TGAGAATGAGGATAAGTAGGGAAGAAATTTTTGAACATCAAAATTTACNGGAGNCTATTT
JMSF036B15+ TGAGAATGAGGATAAGTAGGGAAGAAATTTTTGAACNTCAAAATNTACNGGNGACTATTT
                      ____________________________________________________________
consensus TGAGAATGAGGATAAGTAGGGAAGAAATTTTTGAACATCAAAATTTACAGGAGACTATTT
 
. : . : . : . : . : . :
JMFF042D06+ CCAGAAAATTAACAGAAAAAAAAAATCAAAAGAAATATGTTAAGAAACAAAACATATATG
JMSF053E23+ CCNGAAAATTANCNGAAAAAAAAAATCAAAAGAAATATGTTAAGAAACAAAACATATATG
JMSF044C07+ CCAGAAAATTAACAGAAAAAAAAAATCAAAAGAAATATGTTAAGAAACAAAACATATATG
JMSF036B15+ CCNGAAAATTAACNGAAAAAAAAAATCAAAAGAAATATGTTAAGAAACAAAACATATATG
                      ____________________________________________________________
consensus CCAGAAAATTAACAGAAAAAAAAAATCAAAAGAAATATGTTAAGAAACAAAACATATATG
 
. : . : . : . : . : . :
JMFF042D06+ GCTCAGCGAGTAAGAATTGAATCAATAAGCTATAATCAATAGCTTTCGTAGTTTGATGGT
JMSF053E23+ GCTCAGCGAGTAAGAATTGAATCAATAAGCTATAATCAATAGCTTTCGTAGTTTGATGGT
JMSF044C07+ GCTCAGCGAGTAAGAATTGAATCAATAAGCTATAATCAATAGCTTTCGTAGTTTGATGGT
JMSF036B15+ GCTCAGCGAGTAAGAATTGAATCAATAAGCTATAATCAATAGATTTCGTAGTTTGATGGT
                      ____________________________________________________________
consensus GCTCAGCGAGTAAGAATTGAATCAATAAGCTATAATCAATAGCTTTCGTAGTTTGATGGT
 
. : . : . : . : . : . :
JMFF042D06+ ATTATACTTCAGACATCACAGCCACAAAAACTCATCGGAAGCGAAGAAGAAAGATGCTAA
JMSF053E23+ ATTATACTTCAGACATCACAGCCACAAAAACTCATCGGAAGCGAAGAAGAAAGATGCTAA
JMSF044C07+ ATTATACTTCAGACATCACAGCCACAAAAACTCATCGGAAGCGAAGAAGAAAGATGCTAA
JMSF036B15+ ATTATACTTCAGACATCACAGCCACAAAAACTCATCGGAAGCGAAGAAGAAAGATGCTAA
                      ____________________________________________________________
consensus ATTATACTTCAGACATCACAGCCACAAAAACTCATCGGAAGCGAAGAAGAAAGATGCTAA
 
. : . : . : . : . : . :
JMFF042D06+ CACTACAAACAAAAGCTAGAAAGAGTGAGGCGAAGAGAATAGCGGAACCCT
JMSF053E23+ CACTACAAACAAAAGCTAGAAAGAGTGAGGCGAAGAGAATAGCGGAACCCTAATTTGA
JMSF044C07+ CACTACAAACAAAAGCTAGAAAGAGTGAGGCGAAGAGAATAGCGGAACCCTAATTTGA
JMSF036B15+ CACTACAAACAAAAGCTAGAAAGAGTGAGGCGAAGAGAATAGCGGAACCCTAATTTGATC
                      ____________________________________________________________
consensus CACTACAAACAAAAGCTAGAAAGAGTGAGGCGAAGAGAATAGCGGAACCCTAATTTGATC