Previous Contig 007068:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF024D06Sequence658007068 (2)sp|P48785|PRH_ARATH4e-09Pathogenesis-related homeodomain protein (PRHA).>pir|T08555|T08555 pathogenesis-764012348 (2)
JMSF036A19Sequence668007068 (2)609012348 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF024D06+ GGCC
                      ____________________________________________________________
consensus GGCC
 
. : . : . : . : . : . :
JMSF024D06+ CTTCCAACCTTCTGTGGAGTAAGCATCAATCAGGTTCTGCTCCAGTTTCATTTTTATCAG
JMSF036A19+ AG
                      ____________________________________________________________
consensus CTTCCAACCTTCTGTGGAGTAAGCATCAATCAGGTTCTGCTCCAGTTTCATTTTTATCAG
 
. : . : . : . : . : . :
JMSF024D06+ GAGGTACCTAGTCCGCCTGTGCAAACGAGAAACCTCATCAAGCTCTGCATTGCGCTTCCT
JMSF036A19+ GAGGTACCTAGTCCGCCTGTGCAAACGAGAAACCTCATCAAGCTCTGCATTGCGCTTCCT
                      ____________________________________________________________
consensus GAGGTACCTAGTCCGCCTGTGCAAACGAGAAACCTCATCAAGCTCTGCATTGCGCTTCCT
 
. : . : . : . : . : . :
JMSF024D06+ TCTCTTTGCCCTTTTCCTTTTCTTTAACCTATCATATTCAATGTCAGCCTCCTCATTTTC
JMSF036A19+ TCTCTTTGCCCTTTTCCTTTTCTTTAACCTATCATATTCAATGTCAGCCTCCTCATTTTC
                      ____________________________________________________________
consensus TCTCTTTGCCCTTTTCCTTTTCTTTAACCTATCATATTCAATGTCAGCCTCCTCATTTTC
 
. : . : . : . : . : . :
JMSF024D06+ CCCATTTTTCTTGGAATCAACTTTCTGAAGCTTCCGTACTTTGCAGGTCAATGCAGACTG
JMSF036A19+ CCCATTTTTCTTGGAATCAACTTTCTGAAGCTTCCGTACTTTGCAGGTCAATGCAGACTG
                      ____________________________________________________________
consensus CCCATTTTTCTTGGAATCAACTTTCTGAAGCTTCCGTACTTTGCAGGTCAATGCAGACTG
 
. : . : . : . : . : . :
JMSF024D06+ CTTTTCTGGTGATTTAGTTTTACTAAAAATTGCTTTTTGAAGTGTTTTTCCTATTGAAGA
JMSF036A19+ CTTTTCTGGTGATTTAGTTTTACTAAAAATTGCTTTTTGAAGTGTTTTTCCTATTGAAGA
                      ____________________________________________________________
consensus CTTTTCTGGTGATTTAGTTTTACTAAAAATTGCTTTTTGAAGTGTTTTTCCTATTGAAGA
 
. : . : . : . : . : . :
JMSF024D06+ GCCTTTCCCCTTCCCTTCACATGGGTTTTCAATAACCATCTTCTTTGACAAACATGAACT
JMSF036A19+ GCCTTTCCCCTTCCCTTCACATGGGTTTTCAATAACCATCTTCTTTGACAAACATGAACT
                      ____________________________________________________________
consensus GCCTTTCCCCTTCCCTTCACATGGGTTTTCAATAACCATCTTCTTTGACAAACATGAACT
 
. : . : . : . : . : . :
JMSF024D06+ AGTCTTTTGATGTTTTGGATTTACCTTTGGCCTCTTCTTGAGAGATTTTTTTGTTCCATT
JMSF036A19+ AGTCTTTTGATGTTTTGGATTTACCTTTGGCCTCTTCTTGAGAGATTTTTTTGTTCCATT
                      ____________________________________________________________
consensus AGTCTTTTGATGTTTTGGATTTACCTTTGGCCTCTTCTTGAGAGATTTTTTTGTTCCATT
 
. : . : . : . : . : . :
JMSF024D06+ TTTAATTTGAATGAGTTTCTCAACATTTTTATGAGTTTCTCTCTTCACTGTTCCTGGCAT
JMSF036A19+ TTTAATTTGAATGAGTTTCTCAACATTTTTATGAGTTTCTCTCTTCACTGTTCCTGGCAT
                      ____________________________________________________________
consensus TTTAATTTGAATGAGTTTCTCAACATTTTTATGAGTTTCTCTCTTCACTGTTCCTGGCAT
 
. : . : . : . : . : . :
JMSF024D06+ ATTGATTTGTCATGCATGAAACTGAGAGGAAAGACAGAATGGGTGAAGATCTGGAATTGA
JMSF036A19+ ATTGATTTGTCATGCATGAAACTGAGAGGAAAGACAGAATGGGTGAAGATCTGGAATTGA
                      ____________________________________________________________
consensus ATTGATTTGTCATGCATGAAACTGAGAGGAAAGACAGAATGGGTGAAGATCTGGAATTGA
 
. : . : . : . : . : . :
JMSF024D06+ GTTGCAGTTCTGATGGCTCAGTACTAGCGGCGAAGTGGGTGTGCTTCGAATGCTGAAATT
JMSF036A19+ GTTGCAGTTCTGATGGCTCAGTACTAGCGGCGAAGTGGGTGTGCTTCGAATGCTGAAATT
                      ____________________________________________________________
consensus GTTGCAGTTCTGATGGCTCAGTACTAGCGGCGAAGTGGGTGTGCTTCGAATGCTGAAATT
 
. : . : . : . : . : . :
JMSF024D06+ GATTGATTGAGTATAGTGGAAGAAAGAGCACAAAATATTCAAAAATTCAAGTTC
JMSF036A19+ GATTGATTGAGTATAGTGGAAGAAAGAGCACAAAATATTCAAAAATTCAAGTTCTTGTAA
                      ____________________________________________________________
consensus GATTGATTGAGTATAGTGGAAGAAAGAGCACAAAATATTCAAAAATTCAAGTTCTTGTAA
 
. : . : . : . : . : . :
JMSF036A19+ GAGGAGGTCATGAGATGCTTTTTGGGGTTGGACTTCCCGGCCAGCCAAAACGGTTCAGCC
                      ____________________________________________________________
consensus GAGGAGGTCATGAGATGCTTTTTGGGGTTGGACTTCCCGGCCAGCCAAAACGGTTCAGCC