Previous Contig 007061:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF035P21Sequence288007061 (3)699013720 (4)gb:AY040023_15605238e-05Arabidopsis thaliana putative phytochrome A supressor spa1 protein (At1g53090) m
JMSF036G10Sequence269007061 (3)174013720 (4)
JMSF047I16Sequence180007061 (3)736013720 (4)gb:AP000413_18200792e-11Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone: K7L4.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF036G10+ GAGAGAGAGAGAGAGAGAGAGAGAGA
JMSF047I16+ GAGAGAGAGAGAGAGAGAGAGAGAGA
JMSF035P21+ GANACACANATATNTCTANAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
                      ____________________________________________________________
consensus GANACACANATATNTCTANAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
 
. : . : . : . : . : . :
JMSF036G10+ GAGAGAGAGAGGGGTATACTATACCATTTATCACTATATNTCTCACCCAGTAGAAGGAAA
JMSF047I16+ GAGAGAGAGAGGGGTATACTATACCATTTATCACTATATCTCTCACCCAGTAGAAGGAAA
JMSF035P21+ GAGAGAGAGAGGGGTATACTATACCATTTATCACTATATCTCTCACCCAGTAGAAGGAAA
                      ____________________________________________________________
consensus GAGAGAGAGAGGGGTATACTATACCATTTATCACTATATCTCTCACCCAGTAGAAGGAAA
 
. : . : . : . : . : . :
JMSF036G10+ GGAAAACTGGCAAAGGAGCTCAGTTACCTGTGTTTTAGCATGAAAGCAAACAAAACAATA
JMSF047I16+ GGAAAACTGGCAAAGGAGCTCAGTTACCTGTGTTTTAGCATGAAAGCAAACAAAACAATA
JMSF035P21+ GGAAAACTGGCAAAGGAGCTCAGTTACCTGTGTTTTAGCATGAAAGCAAACAAAACAATA
                      ____________________________________________________________
consensus GGAAAACTGGCAAAGGAGCTCAGTTACCTGTGTTTTAGCATGAAAGCAAACAAAACAATA
 
. : . : . : . : . : . :
JMSF036G10+ AGAACCACAGAACAGATGNTTTTCAGATACTGCAAAACCCCCCAGAAACACACTGGGAAG
JMSF047I16+ AGAACCACAGAACAGATGCTTTTCAGATACTGC
JMSF035P21+ AGAACCACAGAACAGATGCTTTTCAGATACTGCAAAACCCCCCAGAAACACACTGGGAAG
                      ____________________________________________________________
consensus AGAACCACAGAACAGATGCTTTTCAGATACTGCAAAACCCCCCAGAAACACACTGGGAAG
 
. : . : . : . : . : . :
JMSF036G10+ CTTTTATTCCAAGAACAAACCACAGCCTCATAAACTTCATGTACTATTTTATTCTTTTC
JMSF035P21+ CTTTTATTCCAAGAACAAACCACAGCCTCATAAACTTCATGTACTATTTTATTCTTTTCC
                      ____________________________________________________________
consensus CTTTTATTCCAAGAACAAACCACAGCCTCATAAACTTCATGTACTATTTTATTCTTTTCC