Previous Contig 007059:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036E16Sequence561007059 (9)pir|T09884|T098849e-24hypothetical protein T22A6.40 - Arabidopsis thaliana>gb:ATCHRIV61_1546304 Arabid711021486gb:AY087672_15727003e-18Arabidopsis thaliana clone 37543 mRNA, complete sequence.
JMFS077B11Sequence119007059 (9)
JMSF009D20Sequence253007059 (9)180007059 (9)
JMSF009E20Sequence441007059 (9)gb:AY087672_15727002e-05Arabidopsis thaliana clone 37543 mRNA, complete sequence.734007059 (9)gb:AY087672_15727009e-27Arabidopsis thaliana clone 37543 mRNA, complete sequence.
JMSF021J23Sequence692007059 (9)gb:AY087672_15727008e-27Arabidopsis thaliana clone 37543 mRNA, complete sequence.758001804 (183)sp|P12329|CB21_MAIZEe-133Chlorophyll a-b binding protein 1, chloroplast precursor (LHCII type I CAB-1) (L
JMSF035P13Sequence624007059 (9)gb:AY087672_15727009e-21Arabidopsis thaliana clone 37543 mRNA, complete sequence.680007059 (9)gb:AY087672_15727002e-26Arabidopsis thaliana clone 37543 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF035P13- TTACAGATCTCTA
rJMSF009D20- TTACAGATCTCTA
rJMSF009E20- ATACAATACAAGCATTACAGATCTCTA
                      ____________________________________________________________
consensus ATACAATACAAGCATTACAGATCTCTA
 
. : . : . : . : . : . :
rJMSF035P13- ATCCAAATGATATAAATCGAGTTAAAAACAAATACAGATAGATCATAGATGAATATGAAG
rJMSF009D20- ATCCNAATGATATANNTCGAGTTAAAANCAAATNCAGATAGATCNTAGATGAGTATGAAG
rJMSF009E20- ATCCAAATGATATAAATCGAGTTAAAAACAAATACAGATAGATCATAGATGAATATGAAG
JMSF021J23+ CAAATACAGATAGATCATAGATGAATATGAAG
                      ____________________________________________________________
consensus ATCCAAATGATATAAATCGAGTTAAAAACAAATACAGATAGATCATAGATGAATATGAAG
 
. : . : . : . : . : . :
rJMSF035P13- GAATAATAATAAAAGTGAAGCCCAAATTTTGGTGATTTTTATCACGTTTGTTTGTGACGA
rJMSF009D20- GAATANTANTAANAGTGAAGCCCNNATTTTGGTGATTTTTATCACGTTTGTTTGTGACGA
rJMSF009E20- GAATAATAATAAAAGTGAAGCCCAAATTTTGGTGATTTTTATCACGTTTGTTTGTGACGA
JMSF021J23+ GAATAATAATAAAAGTGAAGCCCAAATTTTGGTGATTTTTATCACGTTTGTTTGTGACGA
                      ____________________________________________________________
consensus GAATAATAATAAAAGTGAAGCCCAAATTTTGGTGATTTTTATCACGTTTGTTTGTGACGA
 
. : . : . : . : . : . :
rJMSF035P13- TTACTGGAATTCATCTTCTCGTAATACCGGATCGAGAGGAGGGAGAGCGAGAGATTCATT
rJMSF009D20- TTACTGGAATTCATCTTCTCGTAATACCGGATCGAGAGG
rJMSF009E20- TTACTGGAATTCATCTTCTCGTAATACCGGATCGAGAGGAGGGAGAGCGAGAGATTCATT
JMSF021J23+ TTACTGGAATTCATCTTCTCGTAATACCGGATCGAGAGGAGGGAGAGCGAGAGATTCATT
                      ____________________________________________________________
consensus TTACTGGAATTCATCTTCTCGTAATACCGGATCGAGAGGAGGGAGAGCGAGAGATTCATT
 
. : . : . : . : . : . :
rJMSF035P13- TCGTCGTTTCCCCACCGTGTTTTCCCGGCGGCGAATTTGGCCGACGAAGGCTTTGGAGGC
rJMSF009E20- TCGTCGTTTCCCCACCGTGTTTTCCCGGCGGCGAATTTGGCCGACGAAGGCTTTGGAGGC
JMSF021J23+ TCGTCGTTTCCCCACCGTGTTTTCCCGGCGGNGAATTTGGCCGACGAAGGCTTTGGAGGC
                      ____________________________________________________________
consensus TCGTCGTTTCCCCACCGTGTTTTCCCGGCGGCGAATTTGGCCGACGAAGGCTTTGGAGGC
 
. : . : . : . : . : . :
rJMSF035P13- GGGGGCAGGCAAGGCCAGGTACATGCCGGCGAGGAGGAGGAAGAGGAGGAGGAGGACGAC
rJMSF009E20- GGGGGCAGGCAAGGCCAGGTACATGCCGGCGAGGAGGAGGAAGAGGAGGAGGAGGACGAC
JMSF021J23+ GGGGGCAGGCAAGGCCAGGTACATGCCGGCGAGGAGGAGGAAGAGGAGGAGGAGGACGAC
JMSF035P13+ GAGGAAGAGGAGGAGGAGGACGAC
                      ____________________________________________________________
consensus GGGGGCAGGCAAGGCCAGGTACATGCCGGCGAGGAGGAGGAAGAGGAGGAGGAGGACGAC
 
. : . : . : . : . : . :
rJMSF035P13- GACGGTTTAACTAGCGGCCAGAGGTGAAGCGAGTAGAGCCGCCGGAAGCCGCCGAGGGCG
rJMSF009E20- GACGGTTTAACTAGCGGCCAGAGGTGAAGCGAGTAGAGCCGCCGGAAGCCGCCGAGGGCG
JMSF021J23+ GACGGTTTAACTAGCGGCCAGAGGTGAAGCGAGTAGAGCCGCCGGAAGCCGCCGAGGGCG
JMSF035P13+ GACGGTTTAACTAGCGGCCAGAGGTGAAGCGAGTAGAGCCGCCGGAAGCCGCCGAGGGCG
                      ____________________________________________________________
consensus GACGGTTTAACTAGCGGCCAGAGGTGAAGCGAGTAGAGCCGCCGGAAGCCGCCGAGGGCG
 
. : . : . : . : . : . :
rJMSF035P13- AGGACCACGTTACGGAGCTGCTGCTGTTGCTGATTCCGGCGGGAGCCGTCCTTGAGGCAC
JMFF036E16+ CCGTCCTTGTTGCAC
rJMSF009E20- AGGACCACGTTACGGAGCTGCTGCTGTTGCTGATTCCGGCGGGAGCCGTCCTTGAGGCAC
JMSF021J23+ AGGACCACGTTACGGAGCTGCTGCTGTTGCTGATTCCGGCGGGAGCCGTCCTTGAGGCAC
JMSF035P13+ AGGACCACGTTACGGAGCTGCTGCTGTTGCTGATTCCGGCGGGAGCCGTCCTTGAGGCAC
                      ____________________________________________________________
consensus AGGACCACGTTACGGAGCTGCTGCTGTTGCTGATTCCGGCGGGAGCCGTCCTTGAGGCAC
 
. : . : . : . : . : . :
rJMSF035P13- ATCAGCTCCCAGAGCCGCTCGTCCTGCGCCGTCCGCTTCCACAGCTTGCTAACGCACGCC
JMFF036E16+ ATCACCTCCCACAACCGCTCGTCCTGCGCCGTCCGGTTCCACTGCTTGCTAACGCACGCC
rJMSF009E20- ATCAGCTCCCAGAGCCGCTCGTCCTGCGCCGTCCGCTTCCACAGCTTGCTAACGCACGCC
JMSF021J23+ ATCAGCTCCCAGAGCCGCTCGTCCTGCGCCGTCCGCTTCCACAGCTTGCTAACGCACGCC
JMSF009E20+ CCACAGCTTGCTAACGCACGCC
JMSF035P13+ ATCAGCTCCCAGAGCCGCTCGTCCTGCGCCGTCCGCTTCCACAGCTTGCTAACGCACGCC
                      ____________________________________________________________
consensus ATCAGCTCCCAGAGCCGCTCGTCCTGCGCCGTCCGCTTCCACAGCTTGCTAACGCACGCC
 
. : . : . : . : . : . :
rJMSF035P13- GCCCACGCTAGCGTGTGCCAGTCCACGTGTTTCAGCACTTCGTACAGCAAGTTCTCGTCC
JMFF036E16+ GCCCACGCTAACGTGCGCGCGTCGACGTGCTTCAGCACCTCGTACAGCAAGTTCTCGTCC
rJMSF009E20- GCCCACGCTAGCGTGCGCCAGTCCACGTGTTTCAGCACTTCGTACAGCAAGTTCTCGTCC
JMSF021J23+ GCCCACGCTAGCGTGCGCCAGTCCACGTGTTTCAGCACTTCGTACAGCAAGTTCTCGTCC
JMSF009E20+ GCCCACGCTAGCGTGCGCCAGTCCACGTGTTTCAGCACTTCGTACAGCAAGTTCTCGTCC
JMSF035P13+ GCCCACGCTAGCGTGTGCCAGTCCACGTGTTTCAGCACTTCGTACAGCAAGTTCTCGTCC
                      ____________________________________________________________
consensus GCCCACGCTAGCGTGCGCCAGTCCACGTGTTTCAGCACTTCGTACAGCAAGTTCTCGTCC
 
. : . : . : . : . : . :
rJMSF035P13- AACAACACCGATTCCGTCGGCATCGGTCCCGCCGTCGCCGTCGCCGCTAACGTACGCCCG
JMFF036E16+ ATCAACAC
rJMSF009E20- AACAACACCGATTCCGTCGGCATCGGTCCCGCCGTCGCCGTCGCCGCTAACGTACGCCCG
JMSF021J23+ AACAACACCGATTCCGTCGGCATCGGTCCCGCCGTCGCCGTCGCCGCTAACGTACGCCCG
JMSF009E20+ AACAACACCGATTCCGTCGGCATCGGTCCCGCCGTCGCCGTCGCCGCTAACGTACGCCCG
JMSF035P13+ AACAACACCGATTCCGTCGGCATCGGTCCCGCCGTCGCCGTCGCCGCTAACGTACGCCCG
                      ____________________________________________________________
consensus AACAACACCGATTCCGTCGGCATCGGTCCCGCCGTCGCCGTCGCCGCTAACGTACGCCCG
 
. : . : . : . : . : . :
rJMSF035P13- GACTCTTTCTCCTCCACCTTCGTCTTCTTCTTCTCCTCCTCCTCCTCCTTCAG
rJMSF009E20- GACTCTTTCTCCTCCACCTTCGTCTTCTTCTTCTCCTCCTCCTCCTCCTTCAGACCGTGG
JMSF021J23+ GACTCTTTCTCCTCCACCTTCGTCTTCTTCTTCTCCTCCTCCTCCTCCTTCAGACCGTGG
JMFS077B11+ TCTTCTTCTTCTCCTCCTCCTCCTCCTTCAGACCGTGG
JMSF009E20+ GACTCTTTCTCCTCCACCTTCGTCTTCTTCTTCTCCTCCTCCTCCTCCTTCAGACCGTGG
JMSF009D20+ CCTTCAGACCGTGG
JMSF035P13+ GACTCTTTCTCCTCCACCTTCGTCTTCTTCTTCTCCTCCTCCTCCTCCTTCAGACCGTGG
                      ____________________________________________________________
consensus GACTCTTTCTCCTCCACCTTCGTCTTCTTCTTCTCCTCCTCCTCCTCCTTCAGACCGTGG
 
. : . : . : . : . : . :
rJMSF009E20- ATTCCGTCGCCGTCGGGAGTATGGGGCCGCTTCATCGGCAGATCTGA
JMSF021J23+ ATTCCGTCGCCGTCGGGAGTATGGGGCCGCTTCATCGGCAGATCTGAACAAAAATA
JMFS077B11+ ATTCCGTCGCCGTCGGGAGTATGGGGCCGCTTCATCGGCAGATCTGAACAAAAATATAGA
JMSF009E20+ ATTCCGTCGCCGTCGGGAGTATGGGGCCGCTTCATCGGCAGATCTGAACAAAAATATAGA
JMSF009D20+ ATTCCGTCGCCGTCGGGAGTATGGGGCCGCTTCATCGGCAGATCTGAACAAAAATATAGA
JMSF035P13+ ATTCCGTCGCCGTCGGGAGTATGGGGCCGCTTCATCGGCAGATCTGAACAAAAATATAGA
                      ____________________________________________________________
consensus ATTCCGTCGCCGTCGGGAGTATGGGGCCGCTTCATCGGCAGATCTGAACAAAAATATAGA
 
. : . : . : . : . : . :
JMFS077B11+ GGGAAAAAGGTGCAACTCCGA
JMSF009E20+ GGGAAAAAGGTGCAACTCCGAGGTTAGGTATATAATTTGAAGAAAATAGGGATTGCTGGA
JMSF009D20+ GGGAAAAAGGTGCAACTCCGAGGTTAGGTATATAATTTGAAGAAAATAGGGATTGCTGGA
JMSF035P13+ GGGAAAAAGGTGCAACTCCGAGGTTAGGTATATAATTTGAAGAAAATAGGGATTGCTGGA
                      ____________________________________________________________
consensus GGGAAAAAGGTGCAACTCCGAGGTTAGGTATATAATTTGAAGAAAATAGGGATTGCTGGA
 
. : . : . : . : . : . :
JMSF009E20+ AAATGGGATGTAGTGGTTCCACAATTACGCAGCATCACATGCATATGGGGCTTTCTTTAT
JMSF009D20+ AAATGGGATGTAGTGGTTCCACAATTACGCAGCATCACATGCATATGGGGCTTTCTTTAT
JMSF035P13+ AAATGGGATGTAGTGGTTCCACAATTACGCAGCATCACATGCATATGGGGCTTTCTTTAT
                      ____________________________________________________________
consensus AAATGGGATGTAGTGGTTCCACAATTACGCAGCATCACATGCATATGGGGCTTTCTTTAT
 
. : . : . : . : . : . :
JMSF009E20+ CATTATCGACAATCAGAAAGTTGGAGAAATGAATGCCGTTTCCGGGAGTGGATTCCTCC
JMSF009D20+ CATTATCGACAATCAGAAAGTTGGAGAAATGAATGCCGTTTCCGGGAGTGGATTCCTCC
JMSF035P13+ CATTATCGACAATCAGAAAGTTGGAGAAATGAATGCCGTTTCCGGGAGTGGATTCCTCCA
                      ____________________________________________________________
consensus CATTATCGACAATCAGAAAGTTGGAGAAATGAATGCCGTTTCCGGGAGTGGATTCCTCCA