Previous Contig 007056:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028M18Sequence456007056 (2)gb:AB007648_15102002e-25Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MKD15.659009563 (3)gb:AK117961_18159678e-12Arabidopsis thaliana At5g23240 mRNA for unknown protein, complete cds, clone: RA
JMSF035P05Sequence660007056 (2)gb:AB007648_15102005e-59Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MKD15.666009563 (3)gb:AK117961_18159677e-14Arabidopsis thaliana At5g23240 mRNA for unknown protein, complete cds, clone: RA

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF035P05+ C
                      ____________________________________________________________
consensus C
 
. : . : . : . : . : . :
JMSF035P05+ TCCACAACCGAGATGCAATCAACCGGGCATGCACCAATGGCTTCTTGAATTTTGTGCTCG
                      ____________________________________________________________
consensus TCCACAACCGAGATGCAATCAACCGGGCATGCACCAATGGCTTCTTGAATTTTGTGCTCG
 
. : . : . : . : . : . :
JMSF035P05+ GGATCTGCCCATTGTGCAACAACTCTGGCTCGTCCATAAACAGATTCAACCGCAAATGTT
                      ____________________________________________________________
consensus GGATCTGCCCATTGTGCAACAACTCTGGCTCGTCCATAAACAGATTCAACCGCAAATGTT
 
. : . : . : . : . : . :
JMSF035P05+ TTCTCAGCAAATAAAGCACATTTTAGGCAGCCTACACACCTCACTTCATCAACAATTACA
                      ____________________________________________________________
consensus TTCTCAGCAAATAAAGCACATTTTAGGCAGCCTACACACCTCACTTCATCAACAATTACA
 
. : . : . : . : . : . :
JMFF028M18+ AAACCATGCAGAGTATATTGGCTTGCCTGTGTAGCCT
JMSF035P05+ GCTCTATTTTCACTCTCTGGACCAAACCATGCAGAGTATATTGGCTTGCCTGTGTAGCCT
                      ____________________________________________________________
consensus GCTCTATTTTCACTCTCTGGACCAAACCATGCAGAGTATATTGGCTTGCCTGTGTAGCCT
 
. : . : . : . : . : . :
JMFF028M18+ CGTAAATCCGCAAATTTTGATTGCTCCTTATCGTAGACGAAACGGGAGTTGGGGTCAGAC
JMSF035P05+ CGTAAATCCGCAAATTCTGATTGCTCCTTATCGTAGACGAAACGGGAGTTGGGGTCAGAC
                      ____________________________________________________________
consensus CGTAAATCCGCAAATTTTGATTGCTCCTTATCGTAGACGAAACGGGAGTTGGGGTCAGAC
 
. : . : . : . : . : . :
JMFF028M18+ AGAAGAGCGTAGGCTTCGTTGAGTACGATGGCCATGTCGTGACCCGCCGGGCCGGCGATG
JMSF035P05+ AGAAGAGCGTAGGCTTCGTTGAGTACGATGGCCATGTCGTGACCCGCCGGGCCGGCGATG
                      ____________________________________________________________
consensus AGAAGAGCGTAGGCTTCGTTGAGTACGATGGCCATGTCGTGACCCGCCGGGCCGGCGATG
 
. : . : . : . : . : . :
JMFF028M18+ TCCGGGTGGCACCGCTTCTGTAAAGCTCTGTAGGCCAGCTTGATCTGCGCCTGATCGGAG
JMSF035P05+ TCCGGGTGGCACCGCTTCTGTAAAGCTCTGTAGGCCAGCTTGATCTGCGCCTGATCGGAG
                      ____________________________________________________________
consensus TCCGGGTGGCACCGCTTCTGTAAAGCTCTGTAGGCCAGCTTGATCTGCGCCTGATCGGAG
 
. : . : . : . : . : . :
JMFF028M18+ GAGCTATCGATGCCCAGAAGATCGTAGAGGTCAAGATCCCCAAGGGATGAAGAAGAAGAA
JMSF035P05+ GAGCTATCGATGCCCAGAAGATCGTAGAGGTCAAGATCCCCAAGGGATGAAGAAGAAGAA
                      ____________________________________________________________
consensus GAGCTATCGATGCCCAGAAGATCGTAGAGGTCAAGATCCCCAAGGGATGAAGAAGAAGAA
 
. : . : . : . : . : . :
JMFF028M18+ GACGCAGCAGCTTTGCAGGAGAGTGATTTCCGATTCCATGGATTTGGGAATGGAAATCTT
JMSF035P05+ GACGCAGCAGCTTTGCAGGAGAGTGATTTCCGATTCCATGGATTTGGGAATGGAAATCTT
                      ____________________________________________________________
consensus GACGCAGCAGCTTTGCAGGAGAGTGATTTCCGATTCCATGGATTTGGGAATGGAAATCTT
 
. : . : . : . : . : . :
JMFF028M18+ TGGAGGTTTTGGGAATGTGGAGGGGAGATTGGGGGTGACGATTACACTGCTCCTCCGTAT
JMSF035P05+ TGGAGG-TTTGGGAATGTGGAGGGGAGATTGGGGGTGACGATTACACTGCTCCTCCGTAT
                      ____________________________________________________________
consensus TGGAGGTTTTGGGAATGTGGAGGGGAGATTGGGGGTGACGATTACACTGCTCCTCCGTAT
 
. : . : . : . : . : . :
JMFF028M18+ GGGAAGAGCTGAAGTTGGTGAATGCATTTGCATTTTGCAGTGAGAAAAGGGAGAAAAG
JMSF035P05+ GGGAAGAGCTGAAGTTGGTGAATGCATTTGCATTTTGCAGTGAGAAAAGGGAGAAAAGCC
                      ____________________________________________________________
consensus GGGAAGAGCTGAAGTTGGTGAATGCATTTGCATTTTGCAGTGAGAAAAGGGAGAAAAGCC