Previous Contig 007052:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF019P16Sequence445007052 (2)gb:AB026647_15171949e-08Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MJL12.764012111 (2)gb:AB026647_15171944e-21Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MJL12.
JMSF035O20Sequence582007052 (2)gb:AB026647_15171948e-07Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MJL12.393012111 (2)gb:AB026647_15171943e-05Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MJL12.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF035O20+ CCTCCTCCATTGAATCTTCCACTAAACTCTGTTCCGAGAATT
                      ____________________________________________________________
consensus CCTCCTCCATTGAATCTTCCACTAAACTCTGTTCCGAGAATT
 
. : . : . : . : . : . :
JMSF035O20+ GGGCTTGGCTTTCTTGAACATCCATTAAAGGACCCTCAAACACAATCTTGTAAGCTTCAA
                      ____________________________________________________________
consensus GGGCTTGGCTTTCTTGAACATCCATTAAAGGACCCTCAAACACAATCTTGTAAGCTTCAA
 
. : . : . : . : . : . :
JMSF019P16+ CTCCAAATCAAAACACTCCTGGGTTCCATCCTCAACCACAGCATGACAAGCAGAGA
JMSF035O20+ AATCCTCCAAATCAAAACACTCCTGGGTTCCATCCTCAACCNCAGCATGACAAGCAGAGA
                      ____________________________________________________________
consensus AATCCTCCAAATCAAAACACTCCTGGGTTCCATCCTCAACCACAGCATGACAAGCAGAGA
 
. : . : . : . : . : . :
JMSF019P16+ GCAGATCACCAACCTTGCCGTGGGCAATCAAGCCCGGAGAGACTGTAAGAAAGGCAAGGA
JMSF035O20+ GCAGATCACCAACCTTGCCGTGGGCAATCAAGCCCGGAGAGACTGTAAGAAAGGCAAGGA
                      ____________________________________________________________
consensus GCAGATCACCAACCTTGCCGTGGGCAATCAAGCCCGGAGAGACTGTAAGAAAGGCAAGGA
 
. : . : . : . : . : . :
JMSF019P16+ GCAAGAGGGAAGTGGTGAAGACAAGAGGGAAGAGAAAGGAGACGATTTTGAAGAGATAAG
JMSF035O20+ GCAAGAGGGAAGTGGTGAAGACAAGAGGGAAGAGAAAGGAGACGATTTTGAAGAGATAAG
                      ____________________________________________________________
consensus GCAAGAGGGAAGTGGTGAAGACAAGAGGGAAGAGAAAGGAGACGATTTTGAAGAGATAAG
 
. : . : . : . : . : . :
JMSF019P16+ GGGAGAAGAAGACAAAGTATGACAAGTATAGAGGGTGAGAGAAGAGGAAAGAACAGAATC
JMSF035O20+ GGGAGAAGAAGACAAAGTATGACAAGTATAGAGGGTGAGAGAAGAGGAAAGAACAGAGTC
                      ____________________________________________________________
consensus GGGAGAAGAAGACAAAGTATGACAAGTATAGAGGGTGAGAGAAGAGGAAAGAACAGAGTC
 
. : . : . : . : . : . :
JMSF019P16+ GCTTCAAGTCAGAGATGAGAAGACTGGAAAACCAAGTCTTCCATGGCAGGCACAGCTCCG
JMSF035O20+ GCTTCAAGTCAGAGATGAGAAGACTGGAAAACCAAGTCTTCCATGGCAGGCACAGCTCCG
                      ____________________________________________________________
consensus GCTTCAAGTCAGAGATGAGAAGACTGGAAAACCAAGTCTTCCATGGCAGGCACAGCTCCG
 
. : . : . : . : . : . :
JMSF019P16+ ACATTTCTGCAGCAATGGAATTGAAAAATGGGGAGAAGAATCTGATTATCTTTGGTCAAG
JMSF035O20+ ACATTTCTGCAGCAATGGAATTGAAAAATGGGGAGAAGANTCTGATTATCTTTGGTCAAG
                      ____________________________________________________________
consensus ACATTTCTGCAGCAATGGAATTGAAAAATGGGGAGAAGAATCTGATTATCTTTGGTCAAG
 
. : . : . : . : . : . :
JMSF019P16+ ATGGGGAAAGAAGAGAGAAATGTGGAAGTGTGATGGGAGCAAATGCGGCGTGAATAAAGG
JMSF035O20+ ATGGGGAAAGAAGAGAGAAATGTGGAAGTGTGATGGGAGCAAATGCGGCGTGAATAAAGG
                      ____________________________________________________________
consensus ATGGGGAAAGAAGAGAGAAATGTGGAAGTGTGATGGGAGCAAATGCGGCGTGAATAAAGG
 
. : . : . : . : . : . :
JMSF019P16+ AGGGAAATAGGAGGCAGGAAGAGTCATC
JMSF035O20+ AGGGAAATAGGAGGCAGGAAGAGTCATCAATGGAGTGTAAGGAGGGTGAGAGATTAACTC
                      ____________________________________________________________
consensus AGGGAAATAGGAGGCAGGAAGAGTCATCAATGGAGTGTAAGGAGGGTGAGAGATTAACTC