Previous Contig 007051:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044P06Sequence637007051 (15)gb:NBE504729_16881664e-55Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 1 (brp615010568 (7)gb:NBE504730_16881672e-06Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 2 (brp
JMFF045K18Sequence642007051 (15)gb:NBE504729_16881664e-55Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 1 (brp629010568 (7)
JMFN018L02Sequence577007051 (15)gb:NBE504729_16881665e-54Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 1 (brp
JMFS056E03Sequence619007051 (15)gb:NBE504729_16881664e-55Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 1 (brp
JMFS084C11Sequence606007051 (15)gb:NBE504729_16881662e-54Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 1 (brp
JMFS091F10Sequence627007051 (15)gb:NTA504731_16914232e-65Nicotiana tabacum mRNA for bromodomain-containing RNA-binding protein 1 (brp1 ge
JMFS131D07Sequence628007051 (15)gb:NBE504729_16881664e-55Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 1 (brp
JMFS154A04Sequence641007051 (15)gb:NBE504729_16881663e-58Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 1 (brp
JMSF012L06Sequence545007051 (15)gb:NBE504730_16881674e-42Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 2 (brp747011705 (2)sp|Q9ZPX1|ARF5_ARATH4e-81Probable ADP-ribosylation factor At2g18390.>pir|G84563|G84563 probable ADP-ribos
JMSF035O12Sequence665007051 (15)gb:NBE504729_16881662e-59Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 1 (brp669010568 (7)gb:NBE504730_16881677e-06Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 2 (brp
JMSF039J16Sequence656007051 (15)gb:NBE504729_16881661e-57Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 1 (brp877010568 (7)gb:NBE504730_16881671e-59Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 2 (brp
JMSF040A12Sequence659007051 (15)gb:NBE504729_16881663e-58Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 1 (brp860010568 (7)gb:NBE504730_16881671e-16Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 2 (brp
JMSF040A17Sequence656007051 (15)gb:NBE504729_16881661e-57Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 1 (brp865010568 (7)gb:NBE504730_16881671e-35Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 2 (brp
JMSF040B23Sequence605007051 (15)gb:NBE504730_16881675e-42Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 2 (brp814011705 (2)sp|Q9ZPX1|ARF5_ARATH3e-78Probable ADP-ribosylation factor At2g18390.>pir|G84563|G84563 probable ADP-ribos
JMSF044F07Sequence765007051 (15)gb:NBE504729_16881661e-66Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 1 (brp754024091gb:NBE504730_16881676e-12Nicotiana benthamiana mRNA for bromodomain-containing RNA-binding protein 2 (brp

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF012L06- GGGCTTCAACAAAATTTGCCTACAATCCTTCATCATATTCTCCAGACCGATTCCAT
JMSF040B23- GGGCTTCAACAAAATTTGCCTACAATCCTTCATCATATTCTCCAGACCGATTCCAT
                      ____________________________________________________________
consensus GGGCTTCAACAAAATTTGCCTACAATCCTTCATCATATTCTCCAGACCGATTCCAT
 
. : . : . : . : . : . :
JMSF012L06- TGATCCCTCCTCTGCCAACAACACCAACACTCTTAACATTATCAACACCATTACAAAACT
JMSF040B23- TGATCCCTCCTCTGCCAACAACACCAACACTCTTAACATTATCAACACCATTACAAAACT
JMSF044F07+ AACAACACCAACATTCCTAACATTATCAACACCATTACAAAACT
                      ____________________________________________________________
consensus TGATCCCTCCTCTGCCAACAACACCAACACTCTTAACATTATCAACACCATTACAAAACT
 
. : . : . : . : . : . :
JMSF012L06- TTTCCGGATCTTTATTGGATCCAAAGGACATCGGCCACTTATTTGCCGATAATTTCTTCG
JMSF040B23- TTTCCGGATCTTTATTGGATCCAAAGGACATCGGCCACTTATTTGCCGATAATTTCTTCG
JMFS091F10+ ATCTTTATTGGATCCAAAGGACACCGGCCGCTTATTTGACGATAATTTCTTCG
JMSF044F07+ TTTTCGGATCTTTATTGGATCCAAAGGACACCGGCCGCTTATTTGACGATAATTTCTTCG
JMSF035O12+ CTTCG
                      ____________________________________________________________
consensus TTTCCGGATCTTTATTGGATCCAAAGGACATCGGCCGCTTATTTGCCGATAATTTCTTCG
 
. : . : . : . : . : . :
JMSF012L06- ATTTCCCGTGAGATCTTGGGTTATTGACGGTGGTACTGAAGTGACCGGACTCGATTCGAT
JMSF040B23- ATTTCCCGTGAGATCTTGGGTTATTGACGGTGGTACTGAAGTGACCGGACTCGATTCGAT
JMFS091F10+ ATTTCCCGTGAGATCTAGGGTTATTAACGGTGGTGCTGAAGTGACCCGACTCGATTCGAT
JMSF044F07+ ATTTCCCGTGAGATCTAGGGTTATTAACGGTGGTGCTGAAGTGACCCGACTCGATTCGAT
JMSF040A12+ ATTTCCCGTGAGATCTAGGGTTATTAACGGTGGTGCTGAAGTGACCCGACTCGATTCGAT
JMSF040A17+ TCCCGTGAGATCTAGGGTTATTAACGGTGGTGCTGAAGTGACCCGACTCGATTCGAT
JMSF039J16+ TCCCGTGAGATCTAGGGTTATTAACGGTGGTGCTGAAGTGACCCGACTCGATTCGAT
JMFS154A04+ TTTCCCGTGAGATCTAGGGTTATTAACGGTGGTGCTGAAGTGACCCGACTCGATTCGAT
JMFF045K18+ AGGGTTATTAACGGTGGTGCTGAAGTGACCCGACTCGATTCGAT
JMFS131D07+ AGGGTTATTAACGGTGGTGCTGAAGTGACCCGACTCGATTCGAT
JMFS084C11+ GCTGAAGTGACCCGACTCGATTCGAT
JMFN018L02+ TGACCCGACTCGATTCGAT
JMFF044P06+ AGGGTTATTAACGGTGGTGCTGAAGTGACCCGACTCGATTCGAT
JMFS056E03+ AGGGTTATTAACGGTGGTGCTGAAGTGACCCGACTCGATTCGAT
JMSF035O12+ ATTTCCCGTGAGATCTAGGGTTATTAACGGTGGTGCTGAAGTGACCCGACTCGATTCGAT
                      ____________________________________________________________
consensus ATTTCCCGTGAGATCTAGGGTTATTAACGGTGGTGCTGAAGTGACCCGACTCGATTCGAT
 
. : . : . : . : . : . :
JMSF012L06- CCTTCAGGTTACGGATCTGTTCAAGCTCCGATACTGGCCGTTTCTGAAGCTCATTGAGCT
JMSF040B23- CCTTCAGGTTACGGATCTGTTCAAGCTCCGATACTGGCCGTTTCTGAAGCTCATTGAGCT
JMFS091F10+ CCTTCAGGTTACGGATCTGTTCAAGCTCCGATACCAGCCGTTTCCGAAGCTCGTTGAGCT
JMSF044F07+ CCTTCAGGTTACGGATCTGTTCAAGCTCCGATACCAGCCGTTTCCGAAGCTCGTTGAGCT
JMSF040A12+ CCTTCAGGTTACGGATCTGTTCAAGCTCCGATACCAGCCGTTTCCGAAGCTCGTTGAGCT
JMSF040A17+ CCTTCAGGTTACGGATCTGTTCAAGCTCCGATACCAGCCGTTTCCGAAGCTCGTTGAGCT
JMSF039J16+ CCTTCAGGTTACGGATCTGTTCAAGCTCCGATACCAGCCGTTTCCGAAGCTCGTTGAGCT
JMFS154A04+ CCTTCAGGTTACGGATCTGTTCAAGCTCCGATACCAGCCGTTTCCGAAGCTCGTTGAGCT
JMFF045K18+ CCTTCAGGTTACGGATCTGTTCAAGCTCCGATACCAGCCGTTTCCGAAGCTCGTTGAGCT
JMFS131D07+ CCTTCAGGTTACGGATCTGTTCAAGCTCCGATACCAGCCGTTTCCGAAGCTCGTTGAGCT
JMFS084C11+ CCTTCAGGTTACGGATCTGTTCAAGCTCCGATACCAGCCGTTTCCGAAGCTCGTTGAGCT
JMFN018L02+ CCTTCAGGTTACGGATCTGTTCAAGCTCCGATACCAGCCGTTTCCGAAGCTCGTTGAGCT
JMFF044P06+ CCTTCAGGTTACGGATCTGTTCAAGCTCCGATACCAGCCGTTTCCGAAGCTCGTTGAGCT
JMFS056E03+ CCTTCAGGTTACGGATCTGTTCAAGCTCCGATACCAGCCGTTTCCGAAGCTCGTTGAGCT
JMSF035O12+ CCTTCAGGTTACGGATCTGTTCAAGCTCCGATACCAGCCGTTTCCGAAGCTCGTTGAGCT
                      ____________________________________________________________
consensus CCTTCAGGTTACGGATCTGTTCAAGCTCCGATACCAGCCGTTTCCGAAGCTCGTTGAGCT
 
. : . : . : . : . : . :
JMSF012L06- CGCTTTTCGTGTACGACGTGACGTTGTAGGTCAAATAACCTCCGAAATTGAGGCCATTCG
JMSF040B23- CGCTTTTCGTGTACGACGTGACGTTGTAGGTCAAATAACCTCCGAAATTGAGGCCATTCG
JMFS091F10+ CGCTTTTCGTGTACGACGTGATGTTGTAGGTCAAATAACCTCCGAAATTGAGGCCATTCG
JMSF044F07+ CGCTTTTCGTGTACGACGTGATGTTGTAGGTCAAATAACCTCCGAAATTGAGGCCATTCG
JMSF040A12+ CGCTTTTCGTGTACGACGTGATGTTGTAGGTCAAATAACCTCCGAAATTGAGGCCATTCG
JMSF040A17+ CGCTTTTCGTGTACGACGTGATGTTGTAGGTCAAATAACCTCCGAAATTGAGGCCATTCG
JMSF039J16+ CGCTTTTCGTGTACGACGTGATGTTGTAGGTCAAATAACCTCCGAAATTGAGGCCATTCG
JMFS154A04+ CGCTTTTCGTGTACGACGTGATGTTGTAGGTCAAATAACCTCCGAAATTGAGGCCATTCG
JMFF045K18+ CGCTTTTCGTGTACGACGTGATGTTGTAGGTCAAATAACCTCCGAAATTGAGGCCATTCG
JMFS131D07+ CGCTTTTCGTGTACGACGTGATGTTGTAGGTCAAATAACCTCCGAAATTGAGGCCATTCG
JMFS084C11+ CGCTTTTCGTGTACGACGTGATGTTGTAGGTCAAATAACCTCCGAAATTGAGGCCATTCG
JMFN018L02+ CGCTTTTCGTGTACGACGTGATGTTGTAGGTCAAATAACCTCCGAAATTGAGGCCATTCG
JMFF044P06+ CGCTTTTCGTGTACGACGTGATGTTGTAGGTCAAATAACCTCCGAAATTGAGGCCATTCG
JMFS056E03+ CGCTTTTCGTGTACGACGTGATGTTGTAGGTCAAATAACCTCCGAAATTGAGGCCATTCG
JMSF035O12+ CGCTTTTCGTGTACGACGTGATGTTGTAGGTCAAATAACCTCCGAAATTGAGGCCATTCG
                      ____________________________________________________________
consensus CGCTTTTCGTGTACGACGTGATGTTGTAGGTCAAATAACCTCCGAAATTGAGGCCATTCG
 
. : . : . : . : . : . :
JMSF012L06- ATTTGATAGGCCGTTGATTGAACGAATACGCATCATCTGAGGCGGCCTGCGTGACGACCG
JMSF040B23- ATTTGATAGGCCGTTGATTGAACGAATACGCATCATCTGAGGCGGCCTGCGTGACGACCG
JMFS091F10+ ATTCGATAGGCCGTTGATTGAACGAATACGCATCATCTGAGGCGGTCTGCGTGACGACCG
JMSF044F07+ ATTCGATAGGCCGTTGATTGAACGAATACGCATCATCTGAGGCGGTCTGCGTGACGACCG
JMSF040A12+ ATTCGATAGGCCGTTGATTGAACGAATACGCATCATCTGAGGCGGTCTGCGTGACGACCG
JMSF040A17+ ATTCGATAGGCCGTTGATTGAACGAATACGCATCATCTGAGGCGGTCTGCGTGACGACCG
JMSF039J16+ ATTCGATAGGCCGTTGATTGAACGAATACGCATCATCTGAGGCGGTCTGCGTGACGACCG
JMFS154A04+ ATTCGATAGGCCGTTGATTGAACGAATACGCATCATCTGAGGCGGTCTGCGTGACGACCG
JMFF045K18+ ATTCGATAGGCCGTTGATTGAACGAATACGCATCATCTGAGGCGGTCTGCGTGACGACCG
JMFS131D07+ ATTCGATAGGCCGTTGATTGAACGAATACGCATCATCTGAGGCGGTCTGCGTGACGACCG
JMFS084C11+ ATTCGATAGGCCGTTGATTGAACGAATACGCATCATCTGAGGCGGTCTGCGTGACGACCG
JMFN018L02+ ATTCGATAGGCCGTTGATTGAACGAATACGCATCATCTGAGGCGGTCTGCGTGACGACCG
JMFF044P06+ ATTCGATAGGCCGTTGATTGAACGAATACGCATCATCTGAGGCGGTCTGCGTGACGACCG
JMFS056E03+ ATTCGATAGGCCGTTGATTGAACGAATACGCATCATCTGAGGCGGTCTGCGTGACGACCG
JMSF035O12+ ATTCGATAGGCCGTTGATTGAACGAATACGCATCATCTGAGGCGGTCTGCGTGACGACCG
                      ____________________________________________________________
consensus ATTCGATAGGCCGTTGATTGAACGAATACGCATCATCTGAGGCGGTCTGCGTGACGACCG
 
. : . : . : . : . : . :
JMSF012L06- GCGAATCGTCGTTAG
JMSF040B23- GCGAATCGTCGTTAG
JMFS091F10+ GCGAATCGTCGTTAGGTCGGCCGTTCGCCGCTTGATGGAAGTGTTTCTGTTTTTTCTTGG
JMSF044F07+ GCGAATCGTCGTTAGGTCGGCCGTTCGCCGCTTGATGGAAGTGTTTCTGTTTTTTCTTGG
JMSF040A12+ GCGAATCGTCGTTAGGTCGGCCGTTCGCCGCTTGATGGAAGTGTTTCTGTTTTTTCTTGG
JMSF040A17+ GCGAATCGTCGTTAGGTCGGCCGTTCGCCGCTTGATGGAAGTGTTTCTGTTTTTTCTTGG
JMSF039J16+ GCGAATCGTCGTTAGGTCGGCCGTTCGCCGCTTGATGGAAGTGTTTCTGTTTTTTCTTGG
JMFS154A04+ GCGAATCGTCGTTAGGTCGGCCGTTCGCCGCTTGATGGAAGTGTTTCTGTTTTTTCTTGG
JMFF045K18+ GCGAATCGTCGTTAGGTCGGCCGTTCGCCGCTTGATGGAAGTGTTTCTGTTTTTTCTTGG
JMFS131D07+ GCGAATCGTCGTTAGGTCGGCCGTTCGCCGCTTGATGGAAGTGTTTCTGTTTTTTCTTGG
JMFS084C11+ GCGAATCGTCGTTAGGTCGGCCGTTCGCCGCTTGATGGAAGTGTTTCTGTTTTTTCTTGG
JMFN018L02+ GCGAATCGTCGTTAGGTCGGCCGTTCGCCGCTTGATGGAAGTGTTTCTGTTTTTTCTTGG
JMFF044P06+ GCGAATCGTCGTTAGGTCGGCCGTTCGCCGCTTGATGGAAGTGTTTCTGTTTTTTCTTGG
JMFS056E03+ GCGAATCGTCGTTAGGTCGGCCGTTCGCCGCTTGATGGAAGTGTTTCTGTTTTTTCTTGG
JMSF035O12+ GCGAATCGTCGTTAGGTCGGCCGTTCGCCGCTTGATGGAAGTGTTTCTGTTTTTTCTTGG
                      ____________________________________________________________
consensus GCGAATCGTCGTTAGGTCGGCCGTTCGCCGCTTGATGGAAGTGTTTCTGTTTTTTCTTGG
 
. : . : . : . : . : . :
JMFS091F10+ GGTTAGAACTAGGGTTCAGATGAGGATGAGAATAAGGGGTTTTCCCCATGAATCCACCAC
JMSF044F07+ GGTTAGAACTAGGGTTCAGATGAGGATGAGAATAAGGGGTTTTCCCCATGAATCCACCAC
JMSF040A12+ GGTTAGAACTAGGGTTCAGATGAGGATGAGAATAAGGGGTTTTCCCCATGAATCCACCAC
JMSF040A17+ GGTTAGAACTAGGGTTCAGATGAGGATGAGAATAAGGGGTTTTCCCCATGAATCCACCAC
JMSF039J16+ GGTTAGAACTAGGGTTCAGATGAGGATGAGAATAAGGGGTTTTCCCCATGAATCCACCAC
JMFS154A04+ GGTTAGAACTAGGGTTCAGATGAGGATGAGAATAAGGGGTTTTCCCCATGAATCCACCAC
JMFF045K18+ GGTTAGAACTAGGGTTCAGATGAGGATGAGAATAAGGGGTTTTCCCCATGAATCCACCAC
JMFS131D07+ GGTTAGAACTAGGGTTCAGATGAGGATGAGAATAAGGGGTTTTCCCCATGAATCCACCAC
JMFS084C11+ GGTTAGAACTAGGGTTCAGATGAGGATGAGAATAAGGGGTTTTCCCCATGAATCCACCAC
JMFN018L02+ GGTTAGAACTAGGGTTCAGATGAGGATGAGAATAAGGGGTTTTCCCCATGAATCCACCAC
JMFF044P06+ GGTTAGAACTAGGGTTCAGATGAGGATGAGAATAAGGGGTTTTCCCCATGAATCCACCAC
JMFS056E03+ GGTTAGAACTAGGGTTCAGATGAGGATGAGAATAAGGGGTTTTCCCCATGAATCCACCAC
JMSF035O12+ GGTTAGAACTAGGGTTCAGATGAGGATGAGAATAAGGGGTTTTCCCCATGAATCCACCAC
                      ____________________________________________________________
consensus GGTTAGAACTAGGGTTCAGATGAGGATGAGAATAAGGGGTTTTCCCCATGAATCCACCAC
 
. : . : . : . : . : . :
JMFS091F10+ CGGCATCACCGGATTGGGCCCAACTCGATTCATTCCGGCTAGCTAAGACGGCAGACGCCA
JMSF044F07+ CGGCATCACCGGATTGGGCCCAACTCGATTCATTCCGGCTAGCTAAGACGGCAGACGCCA
JMSF040A12+ CGGCATCACCGGATTGGGCCCAACTCGATTCATTCCGGCTAGCTAAGACGGCAGACGCCA
JMSF040A17+ CGGCATCACCGGATTGGGCCCAACTCGATTCATTCCGGCTAGCTAAGACGGCAGACGCCA
JMSF039J16+ CGGCATCACCGGATTGGGCCCAACTCGATTCATTCCGGCTAGCTAAGACGGCAGACGCCA
JMFS154A04+ CGGCATCACCGGATTGGGCCCAACTCGATTCATTCCGGCTAGCTAAGACGGCAGACGCCA
JMFF045K18+ CGGCATCACCGGATTGGGCCCAACTCGATTCATTCCGGCTAGCTAAGACGGCAGACGCCA
JMFS131D07+ CGGCATCACCGGATTGGGCCCAACTCGATTCATTCCGGCTAGCTAAGACGGCAGACGCCA
JMFS084C11+ CGGCATCACCGGATTGGGCCCAACTCGATTCATTCCGGCTAGCTAAGACGGCAGACGCCA
JMFN018L02+ CGGCATCACCGGATTGGGCCCAACTCGATTCATTCCGGCTAGCTAAGACGGCAGACGCCA
JMFF044P06+ CGGCATCACCGGATTGGGCCCAACTCGATTCATTCCGGCTAGCTAAGACGGCAGACGCCA
JMFS056E03+ CGGCATCACCGGATTGGGCCCAACTCGATTCATTCCGGCTAGCTAAGACGGCAGACGCCA
JMSF035O12+ CGGCATCACCGGATTGGGCCCAACTCGATTCATTCCGGCTAGCTAAGACGGCAGACGCCA
                      ____________________________________________________________
consensus CGGCATCACCGGATTGGGCCCAACTCGATTCATTCCGGCTAGCTAAGACGGCAGACGCCA
 
. : . : . : . : . : . :
JMFS091F10+ TGAATTGCAGCGTCGACGCTGAATTCTTGTGGTTCGGAGGGGAAATCGATCGTTTTTAGG
JMSF044F07+ TGAATTGCAGCGTCGACGCTGAATTCTTGTGGTTCGGAGGGGAAATCGATCGTTTTTAGG
JMSF040A12+ TGAATTGCAGCGTCGACGCTGAATTCTTGTGGTTCGGAGGGGAAATCGATCGTTTTTAGG
JMSF040A17+ TGAATTGCAGCGTCGACGCTGAATTCTTGTGGTTCGGAGGGGAAATCGATCGTTTTTAGG
JMSF039J16+ TGAATTGCAGCGTCGACGCTGAATTCTTGTGGTTCGGAGGGGAAATCGATCGTTTTTAGG
JMFS154A04+ TGAATTGCAGCGTCGACGCTGAATTCTTGTGGTTCGGAGGGGAAATCGATCGTTTTTAGG
JMFF045K18+ TGAATTGCAGCGTCGACGCTGAATTCTTGTGGTTCGGAGGGGAAATCGATCGTTTTTAGG
JMFS131D07+ TGAATTGCAGCGTCGACGCTGAATTCTTGTGGTTCGGAGGGGAAATCGATCGTTTTTAGG
JMFS084C11+ TGAATTGCAGCGTCGACGCTGAATTCTTGTGGTTCGGAGGGGAAATCGATCGTTTTTAGG
JMFN018L02+ TGAATTGCAGCGTCGACGCTGAATTCTTGTGGTTCGGAGGGGAAATCGATCGTTTTTAGG
JMFF044P06+ TGAATTGCAGCGTCGACGCTGAATTCTTGTGGTTCGGAGGGGAAATCGATCGTTTTTAGG
JMFS056E03+ TGAATTGCAGCGTCGACGCTGAATTCTTGTGGTTCGGAGGGGAAATCGATCGTTTTTAGG
JMSF035O12+ TGAATTGCAGCGTCGACGCTGAATTCTTGTGGTTCGGAGGGGAAATCGATCGTTTTTAGG
                      ____________________________________________________________
consensus TGAATTGCAGCGTCGACGCTGAATTCTTGTGGTTCGGAGGGGAAATCGATCGTTTTTAGG
 
. : . : . : . : . : . :
JMFS091F10+ TGGCGTAGAACACATGTATTGGTGGGACGTGTACTACACGCGCTCGCCGGATTTCAAGAA
JMSF044F07+ TGGCGTAGAACACATGTATTGGTGGGACGTGTACTACACGCGCTCGCCGGATTTCAAGAA
JMSF040A12+ TGGCGTAGAACACATGTATTGGTGGGACGTGTACTACACGCGCTCGCCGGATTTCAAGAA
JMSF040A17+ TGGCGTAGAACACATGTATTGGTGGGACGTGTACTACACGCGCTCGCCGGATTTCAAGAA
JMSF039J16+ TGGCGTAGAACACATGTATTGGTGGGACGTGTACTACACGCGCTCGCCGGATTTCAAGAA
JMFS154A04+ TGGCGTAGAACACATGTATTGGTGGGACGTGTACTACACGCGCTCGCCGGATTTCAAGAA
JMFF045K18+ TGGCGTAGAACACATGTATTGGTGGGACGTGTACTACACGCGCTCGCCGGATTTCAAGAA
JMFS131D07+ TGGCGTAGAACACATGTATTGGTGGGACGTGTACTACACGCGCTCGCCGGATTTCAAGAA
JMFS084C11+ TGGCGTAGAACACATGTATTGGTGGGACGTGTACTACACGCGCTCGCCGGATTTCAAGAA
JMFN018L02+ TGGCGTAGAACACATGTATTGGTGGGACGTGTACTACACGCGCTCGCCGGATTTCAAGAA
JMFF044P06+ TGGCGTAGAACACATGTATTGGTGGGACGTGTACTACACGCGCTCGCCGGATTTCAAGAA
JMFS056E03+ TGGCGTAGAACACATGTATTGGTGGGACGTGTACTACACGCGCTCGCCGGATTTCAAGAA
JMSF035O12+ TGGCGTAGAACACATGTATTGGTGGGACGTGTACTACACGCGCTCGCCGGATTTCAAGAA
                      ____________________________________________________________
consensus TGGCGTAGAACACATGTATTGGTGGGACGTGTACTACACGCGCTCGCCGGATTTCAAGAA
 
. : . : . : . : . : . :
JMFS091F10+ AAGGTTTCCCCTAACCGCCGGAAGACGTCGACGG
JMSF044F07+ AAGGTTTCCCCTAACCGCCGGAAGACGTCGACGGCCACAGATCTTTACAGACAACAAAAA
JMSF040A12+ AAGGTTTCCCCTAACCGCCGGAAGACGTCGACGGCCACAGATCTTTACAGACAACAAAAA
JMSF040A17+ AAGGTTTCCCCTAACCGCCGGAAGACGTCGACGGCCACAGATCTTTACAGACAACAAAAA
JMSF039J16+ AAGGTTTCCCCTAACCGCCGGAAGACGTCGACGGCCACAGATCTTTACAGACAACAAAAA
JMFS154A04+ AAGGTTTCCCCTAACCGCCGGAAGACGTCGACGGCCACAGATCTTTACAGACAACAAAAA
JMFF045K18+ AAGGTTTCCCCTAACCGCCGGAAGACGTCGACGGCCACAGATCTTTACAGACAACAAAAA
JMFS131D07+ AAGGTTTCCCCTAACCGCCGGAAGACGTCGACGGCCACAGATCTTTACAGACAACAAAAA
JMFS084C11+ AAGGTTTCCCCTAACCGCCGGAAGACGTCGACGGCCACAGATCTTTACAGACAACAAAAA
JMFN018L02+ AAGGTTTCCCCTAACCGCCGGAAGACGTCGACGGCCACAGATCTTTACAGACAACAAAAA
JMFF044P06+ AAGGTTTCCCCTAACCGCCGGAAGACGTCGACGGCCACAGATCTTTACAGACAACAAAAA
JMFS056E03+ AAGGTTTCCCCTAACCGCCGGAAGACGTCGACGGCCACAGATCTTTACAGACAACAAAAA
JMSF035O12+ AAGGTTTCCCCTAACCGCCGGAAGACGTCGACGGCCACAGATCTTTACAGACAACAAAAA
                      ____________________________________________________________
consensus AAGGTTTCCCCTAACCGCCGGAAGACGTCGACGGCCACAGATCTTTACAGACAACAAAAA
 
. : . : . : . : . : . :
JMSF044F07+ CAGGGAAAGAGAAACGGAGGAATGTATATTATAAAGGTAAGGGTTTCCAGGATTGAGCC
JMSF040A12+ CAGGGAAAGAGAAACGGAGGAATGTATATTATAAAGGTAAGGGTTTCCAGGATTGAGCC
JMSF040A17+ CAGGGAAAGAGAAACGGAGGAATGTATATTATAAAGGTAAGGGTTTCCAGGATTGAGCC
JMSF039J16+ CAGGGAAAGAGAAACGGAGGAATGTATATTATAAAGGTAAGGGTTTCCAGGATTGAGC
JMFS154A04+ CAGGGAAAGAGAAACGGAGGAATGTATATTATAAAGGTAAGG
JMFF045K18+ CAGGGAAAGAGAAACGGAGGAATGTATATTATAAAGGTAAGGGTTTCCAGGATT
JMFS131D07+ CAGGGAAAGAGAAACGGAGGAATGTATATTATAAAGGTAAGGGT
JMFS084C11+ CAGGGAAAGAGAAACGGAGGAATGTATATTATAAAGGTAA
JMFN018L02+ CAGGGAAAGAGAAACGGA
JMFF044P06+ CAGGGAAAGAGAAACGGAGGAATGTATATTATAAAGGTAAGGGTTTCCAGGAT
JMFS056E03+ CAGGGAAAGAGAAACGGAGGAATGTATATTATAAA
JMSF035O12+ CAGGGAAAGAGAAACGGAGGAATGTATATTATAAAGGTAAGGGTTTCCAGGATTGAGCCC
                      ____________________________________________________________
consensus CAGGGAAAGAGAAACGGAGGAATGTATATTATAAAGGTAAGGGTTTCCAGGATTGAGCCC