Previous Contig 007049:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012A20Sequence471007049 (4)gb:AY085096_15701782e-36Arabidopsis thaliana clone 12942 mRNA, complete sequence.776008747 (6)gb:AY085096_15701786e-83Arabidopsis thaliana clone 12942 mRNA, complete sequence.
JMFF039A14Sequence572007049 (4)gb:ATAC009176_15428282e-52Arabidopsis thaliana chromosome III P1 MLP3 genomic sequence, complete sequence.706008747 (6)gb:AY085096_15701783e-89Arabidopsis thaliana clone 12942 mRNA, complete sequence.
JMFF050I01Sequence627007049 (4)gb:ATAC009176_15428284e-62Arabidopsis thaliana chromosome III P1 MLP3 genomic sequence, complete sequence.637008747 (6)gb:AY085096_15701782e-67Arabidopsis thaliana clone 12942 mRNA, complete sequence.
JMSF035M21Sequence657007049 (4)gb:ATAC009176_15428281e-61Arabidopsis thaliana chromosome III P1 MLP3 genomic sequence, complete sequence.669008747 (6)gb:AY085096_15701783e-85Arabidopsis thaliana clone 12942 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF050I01+ G
                      ____________________________________________________________
consensus G
 
. : . : . : . : . : . :
JMFF039A14+ GCGAGTA
JMFF050I01+ TATTTGTGATGCTTCCAGATACCTGTCGAGCTCTGATCGAGTCCAATATAAAAGCGAGTA
JMSF035M21+ TTGTGATGCTTCCAGATACCTGTCGAGCTCTGATCGAGTCCAATATAAAAGCGAGTA
                      ____________________________________________________________
consensus TATTTGTGATGCTTCCAGATACCTGTCGAGCTCTGATCGAGTCCAATATAAAAGCGAGTA
 
. : . : . : . : . : . :
JMFF039A14+ AGGCTGTGTAGGCAAGGCAGAGATATAGTTACTCCATCTTGAAGACTTGATCAGACTTGC
JMFF050I01+ AGGCTGTGTAGGCAAGGCAGAGATATAGTTACTCCATCTTGAAGACTTGATCAGACTTGC
JMSF035M21+ AGGCTGTGTAGGCAAGGCAGAGATATAGTTACTCCATCTTGAAGACTTGATCAGACTTGC
                      ____________________________________________________________
consensus AGGCTGTGTAGGCAAGGCAGAGATATAGTTACTCCATCTTGAAGACTTGATCAGACTTGC
 
. : . : . : . : . : . :
JMFF012A20+ GCCAATCAGGTACACCATAACGTTTTAACAC
JMFF039A14+ CTCGCTGATTAAATACGTTGCTATCAACGGCCAATCAGGTACACCATAACGTTTTAACAC
JMFF050I01+ CTCGCTGATTAAATACGTTGCTATCAACGGCCAATCAGGTACACCATAACGTTTTAACAC
JMSF035M21+ CTCGCTGATTAAATACGTTGCTATCAACGGCCAATCAGGTACACCATAACGTTTTAACAC
                      ____________________________________________________________
consensus CTCGCTGATTAAATACGTTGCTATCAACGGCCAATCAGGTACACCATAACGTTTTAACAC
 
. : . : . : . : . : . :
JMFF012A20+ TTGACCAGCATCTGGTACACTCCATTCCGAATCGGCAGTAATGACGAGCGAGGGAGGCAC
JMFF039A14+ TTGACCAGCATCTGGTACACTCCATTCCGAATCGGCAGTAATGACGAGCGAGGGAGGCAC
JMFF050I01+ TTGACCAGCATCTGGTACACTCCATTCCGAATCGGCAGTAATGACGAGCGAGGGAGGCAC
JMSF035M21+ TTGACCAGCATCTGGTACACTCCATTCCGAATCGGCAGTAATGACGAGCGAGGGAGGCAC
                      ____________________________________________________________
consensus TTGACCAGCATCTGGTACACTCCATTCCGAATCGGCAGTAATGACGAGCGAGGGAGGCAC
 
. : . : . : . : . : . :
JMFF012A20+ GAAGAGCAGCTTCTCTCCCTTCCTGATGTTCTTGAGAGCAACGAGACCTCTCTCTCCTAT
JMFF039A14+ GAAGAGCAGCTTCTCTCCCTTCCTGATGTTCTTGAGAGCAACGAGACCTCTCTCTCCTAT
JMFF050I01+ GAAGAGCAGCTTCTCTCCCTTCCTGATGTTCTTGAGAGCAACGAGACCTCTCTCTCCTAT
JMSF035M21+ GAAGAGCAGCTTCTCTCCCTTCCTGATGTTCTTGAGAGCAACGAGACCTCTCTCTCCTAT
                      ____________________________________________________________
consensus GAAGAGCAGCTTCTCTCCCTTCCTGATGTTCTTGAGAGCAACGAGACCTCTCTCTCCTAT
 
. : . : . : . : . : . :
JMFF012A20+ ATCCACTCTCTGTATGGCCATTTTCTGAGGAGGCATACCCGAGTCCGACAGCCATTTCTG
JMFF039A14+ ATCCACTCTCTGTATGGCCATTTTCTGAGGAGGCATACCCGAGTCCGACAGCCATTTCTG
JMFF050I01+ ATCCACTCTCTGTATGGCCATTTTCTGAGGAGGCATACCCGAGTCCGACAGCCATTTCTG
JMSF035M21+ ATCCACTCTCTGTATGGCCATTTTCTGAGGAGGCATACCCGAGTCCGACAGCCATTTCTG
                      ____________________________________________________________
consensus ATCCACTCTCTGTATGGCCATTTTCTGAGGAGGCATACCCGAGTCCGACAGCCATTTCTG
 
. : . : . : . : . : . :
JMFF012A20+ CAAAGCCGACGCGTTGTCGAGGGAGTCGGTATCACAACCCCAAGGGACTGTCTGGATTTT
JMFF039A14+ CAAAGCCGACGCGTTGTCGAGGGAGTCGGTATCACAACCCCAAGGGACTGTCTGGATTTT
JMFF050I01+ CAAAGCCGACGCGTTGTCGAGGGAGTCGGTATCACAACCCCAAGGGACTGTCTGGATTTT
JMSF035M21+ CAAAGCCGACGCGTTGTCGAGGGAGTCGGTATCACAACCCCAAGGGACTGTCTGGATTTT
                      ____________________________________________________________
consensus CAAAGCCGACGCGTTGTCGAGGGAGTCGGTATCACAACCCCAAGGGACTGTCTGGATTTT
 
. : . : . : . : . : . :
JMFF012A20+ TGCGGCCTCGGTGGAAACTGAGGAACACCGTATGGTGGTGAAACTTGTTGGGTTCCTTCT
JMFF039A14+ TGCGGCCTCGGTGGAAACTGAGGAACACCGTATGGTGGTGAAACTTGTTGGGTTCCTTCT
JMFF050I01+ TGCGGCCTCGGTGGAAACTGAGGAACACCGTATGGTGGTGAAACTTGTTGGGTTCCTTCT
JMSF035M21+ TGCGGCCTCGGTGGAAACTGAGGAACACCGTATGGTGGTGAAACTTGTTGGGTTCCTTCT
                      ____________________________________________________________
consensus TGCGGCCTCGGTGGAAACTGAGGAACACCGTATGGTGGTGAAACTTGTTGGGTTCCTTCT
 
. : . : . : . : . : . :
JMFF012A20+ GAAGAATGTGTGACAGATCGGACTGGAAAGGGCTCTGCGAGACTGAGAGAAAGGAGGGAG
JMFF039A14+ GAAGAATGTGTGACAGATCGGACTGGAAAGGGCTCTGCGAGACTGAGAGAAAGGAGGGAG
JMFF050I01+ GAAGAATGTGTGACAGATCGGACTGGAAAGGGCTCTGCGAGACTGAGAGAAAGGAGGGAG
JMSF035M21+ GAAGAATGTGTGACAGATCGGACTGGAAAGGGCTCTGCGAGACTGAGAGAAAGGAGGGAG
                      ____________________________________________________________
consensus GAAGAATGTGTGACAGATCGGACTGGAAAGGGCTCTGCGAGACTGAGAGAAAGGAGGGAG
 
. : . : . : . : . : . :
JMFF012A20+ GAGAGTGGATTGGAAGATGGTAGAAGCTTCAGGCATGGCTGAAGAGCGAGGGAGGGAAGC
JMFF039A14+ GAGAGTGGATTGGAAGATGGTAGAAGCTTCAGGCATGGCTGAAGAGCGAGGGAGGGAAGC
JMFF050I01+ GAGAGTGGATTGGAAGATGGTAGAAGCTTCAGGCATGGCTGAAGAGCGAGGGAGGGAAGC
JMSF035M21+ GAGAGTGGATTGGAAGATGGTAGAAGCTTCAGGCATGGCTGAAGAGCGAGGGAGGGAAGC
                      ____________________________________________________________
consensus GAGAGTGGATTGGAAGATGGTAGAAGCTTCAGGCATGGCTGAAGAGCGAGGGAGGGAAGC
 
. : . : . : . : . : . :
JMFF012A20+ AAGCAAGCAAGCCACAGAGA
JMFF039A14+ AAGCAAGCAAGCCACAGAGA
JMFF050I01+ AAGCAAGCAAGCCACAGAGA
JMSF035M21+ AAGCAAGCAAGCCACAGAGACAGACGGAGAAGAAGATAAAACCAACCCGCTTAAACCTTC
                      ____________________________________________________________
consensus AAGCAAGCAAGCCACAGAGACAGACGGAGAAGAAGATAAAACCAACCCGCTTAAACCTTC