Previous Contig 007048:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003C10Sequence507007048 (3)gb:AB196698_15296948e-30Daucus carota DcNLP gene for nucellin-like protein, complete cds.681010295 (3)gb:AB196698_15296944e-69Daucus carota DcNLP gene for nucellin-like protein, complete cds.
JMFF043E19Sequence641007048 (3)gb:AB196698_15296943e-52Daucus carota DcNLP gene for nucellin-like protein, complete cds.633010295 (3)gb:AB196698_15296945e-58Daucus carota DcNLP gene for nucellin-like protein, complete cds.
JMSF035M16Sequence645007048 (3)gb:AB196698_15296943e-52Daucus carota DcNLP gene for nucellin-like protein, complete cds.610010295 (3)gb:AK118764_18167262e-54Arabidopsis thaliana At4g33490 mRNA for putative nucellin, complete cds, clone:

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF043E19+ GAGAAAAAACATCATTAACCAAAACACCCAGAGATGAACCTCCAT
JMSF035M16+ GAGAAAAAACATCATTAACCAAAACACCCAGAGATGAACCTCCAT
                      ____________________________________________________________
consensus GAGAAAAAACATCATTAACCAAAACACCCAGAGATGAACCTCCAT
 
. : . : . : . : . : . :
JMFF043E19+ CTGCATACTCAACATCATAGTCACATTGCGTTGGAGACTCACACGTGTAGTCGCCCACAT
JMSF035M16+ CTGCATACTCAACATCATAGTCACATTGCGTTGGAGACTCACACGTGTAGTCGCCCACAT
                      ____________________________________________________________
consensus CTGCATACTCAACATCATAGTCACATTGCGTTGGAGACTCACACGTGTAGTCGCCCACAT
 
. : . : . : . : . : . :
JMFF043E19+ GCAAAGAGGCACAAAGGGGATCCTTGCAAATCACAAGGTCATTGTTGGGCTTGTACAAAG
JMFF003C10+ ATCACAAGGTCATTGTTGGGCTTGTACAAAG
JMSF035M16+ GCAAAGAGGCACAAAGGGGATCCTTGCAAATCACAAGGTCATTGTTGGGCTTGTACAAAG
                      ____________________________________________________________
consensus GCAAAGAGGCACAAAGGGGATCCTTGCAAATCACAAGGTCATTGTTGGGCTTGTACAAAG
 
. : . : . : . : . : . :
JMFF043E19+ GGTGAGGTGCCTTTGTGCAATGGACACAAGGAGCGTCACATTGAAGCCATGTAAGATCAC
JMFF003C10+ GGTGAGGTGCCTTTGTGCAATGGACACAAGGAGCGTCACATTGAAGCCATGTAAGATCAC
JMSF035M16+ GGTGAGGTGCCTTTGTGCAATGGACACAAGGAGCGTCACATTGAAGCCATGTAAGATCAC
                      ____________________________________________________________
consensus GGTGAGGTGCCTTTGTGCAATGGACACAAGGAGCGTCACATTGAAGCCATGTAAGATCAC
 
. : . : . : . : . : . :
JMFF043E19+ TGCCAGTATCAGGATCAACAAAATAGGGCCTTGGAGGATTCCCTATATCCACTTGGGCAA
JMFF003C10+ TGCCAGTATCAGGATCAACAAAATAGGGCCTTGGAGGATTCCCTATATCCACTTGGGCAA
JMSF035M16+ TGCCAGTATCAGGATCAACAAAATAGGGCCTTGGAGGATTCCCTATATCCACTTGGGCAA
                      ____________________________________________________________
consensus TGCCAGTATCAGGATCAACAAAATAGGGCCTTGGAGGATTCCCTATATCCACTTGGGCAA
 
. : . : . : . : . : . :
JMFF043E19+ AGTAAAATCCGTTTGGATAAACGTTGCCATACAGTGGCAGAACAATCGAAGACGGCCCAC
JMFF003C10+ AGTAAAATCCGTTTGGATAAACGTTGCCATACAGTGGCAGAACAATCGAAGACGGCCCAC
JMSF035M16+ AGTAAAATCCGTTTGGATAAACGTTGCCATACAGTGGCAGAACAATCGAAGACGGCCCAC
                      ____________________________________________________________
consensus AGTAAAATCCGTTTGGATAAACGTTGCCATACAGTGGCAGAACAATCGAAGACGGCCCAC
 
. : . : . : . : . : . :
JMFF043E19+ CCCGACTAACCACCGGGGATGAGGACGAAGACGAGGACGAGGACGAGGACGAGGACGAGG
JMFF003C10+ CCCGACTAACCACCGGGGATGAGGACGAAGACGAGGACGAGGACGAGGACGAGGACGAGG
JMSF035M16+ CCCGACTAACCACCGGGGATGAGGACGAAGACGAGGACGAGGACGAGGACGAGGACGAGG
                      ____________________________________________________________
consensus CCCGACTAACCACCGGGGATGAGGACGAAGACGAGGACGAGGACGAGGACGAGGACGAGG
 
. : . : . : . : . : . :
JMFF043E19+ ACGCTCCATCAGAGCCAGGAGATGGCCATTTCCACCATTTCTGATGGCGATCGAGCCGAT
JMFF003C10+ ACGCTCCATCAGAGCCAGGAGATGGCCATTTCCACCATTTCTGATGGCGATCGAGCCGAT
JMSF035M16+ ACGCTCCATCAGAGCCAGGAGATGGCCATTTCCACCATTTCTGATGGCGATCGAGCCGAT
                      ____________________________________________________________
consensus ACGCTCCATCAGAGCCAGGAGATGGCCATTTCCACCATTTCTGATGGCGATCGAGCCGAT
 
. : . : . : . : . : . :
JMFF043E19+ CAGGCGACCCGGCAGCCAAACAAACAGCGGCGACCATAAAGATCGCCGCCGCCACGATTA
JMFF003C10+ CAGGCGACCCGGCAGCCAAACAAACAGCGGCGACCATAAAGATCGCCGCCGCCACGATTA
JMSF035M16+ CAGGCGACCCGGCAGCCAAACAAACAGCGGCGACCATAAAGATCGCCGCCGCCACGATTA
                      ____________________________________________________________
consensus CAGGCGACCCGGCAGCCAAACAAACAGCGGCGACCATAAAGATCGCCGCCGCCACGATTA
 
. : . : . : . : . : . :
JMFF043E19+ ATCTCCCCTCCATCTCTCTCTATCTCTCCCACACAAGCTCAGGTCAAGCCGTCAGACAAG
JMFF003C10+ ATCTCCCCTCCATCTCTCTCTATCTCTCCCACACAAGCTCAGGTCAAGCCGTCAGACAAG
JMSF035M16+ ATCTCCCCTCCATCTCTCTCTATCTCTCCCACACAAGCTCAGGTCAAGCCGTCAGACAAG
                      ____________________________________________________________
consensus ATCTCCCCTCCATCTCTCTCTATCTCTCCCACACAAGCTCAGGTCAAGCCGTCAGACAAG
 
. : . : . : . : . : . :
JMFF043E19+ GAGACAAAGAAGCAGACAACTAACAGAAGAAAATTTTTTTGTTTCAAGATGGGGCC
JMFF003C10+ GAGACAAAGAAGCAGACAACTAACAGAAGAAAATTTTTTTGTTTCAAGATGGGGCC
JMSF035M16+ GAGACAAAGAAGCAGACAACTAACAGAAGAAAATTTTTTTGTTTCAAGATGGGGCCAATC
                      ____________________________________________________________
consensus GAGACAAAGAAGCAGACAACTAACAGAAGAAAATTTTTTTGTTTCAAGATGGGGCCAATC