Previous Contig 007040:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF034L18Sequence646007040 (2)gb:AY062664_15653208e-60Arabidopsis thaliana Unknown protein (At3g25430; MWL2.4) mRNA, complete cds.>gb:679023638gb:AY062664_15653203e-30Arabidopsis thaliana Unknown protein (At3g25430; MWL2.4) mRNA, complete cds.>gb:
JMSF035L17Sequence670007040 (2)gb:AY062664_15653209e-60Arabidopsis thaliana Unknown protein (At3g25430; MWL2.4) mRNA, complete cds.>gb:

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034L18+ CTCGGGATTT
JMSF035L17+ CTCGGGATTT
                      ____________________________________________________________
consensus CTCGGGATTT
 
. : . : . : . : . : . :
JMSF034L18+ GATCCTGTTTATAAATATAGAATCAGCAACTGATCGGGATGCTGGAGATGGAACTGTACA
JMSF035L17+ GATCCTGTTTATAAATATAGAATCAGCAACTGATCGGGATGCTGGAGATGGAACTGTACA
                      ____________________________________________________________
consensus GATCCTGTTTATAAATATAGAATCAGCAACTGATCGGGATGCTGGAGATGGAACTGTACA
 
. : . : . : . : . : . :
JMSF034L18+ GCTGCCAGCTGATGGACTCCTAATACAGTCTTTTGCAGCTAGTTCTTGTGCTCTGGATAA
JMSF035L17+ GCTGCCAGCTGATGGACTCCTAATACAGTCTTTTGCAGCTAGTTCTTGTGCTCTGGATAA
                      ____________________________________________________________
consensus GCTGCCAGCTGATGGACTCCTAATACAGTCTTTTGCAGCTAGTTCTTGTGCTCTGGATAA
 
. : . : . : . : . : . :
JMSF034L18+ GTATGATATGCCATCATTTATGCAAGCATTAAAGTCGAAACCTTCTCGAGCAATAGAGAT
JMSF035L17+ GTATGATATGCCATCATTTATGCAAGCATTAAAGTCGAAACCTTCTCGAGCAATAGAGAT
                      ____________________________________________________________
consensus GTATGATATGCCATCATTTATGCAAGCATTAAAGTCGAAACCTTCTCGAGCAATAGAGAT
 
. : . : . : . : . : . :
JMSF034L18+ CAAATACGATGATTGGCACGAAAAACTGTAAGAAGGCATCCCTGTTTTCAGCTCATCCCT
JMSF035L17+ CAAATACGATGATTGGCACGAAAAACTGTAAGAAGGCATCCCTGTTTTCAGCTCATCCCT
                      ____________________________________________________________
consensus CAAATACGATGATTGGCACGAAAAACTGTAAGAAGGCATCCCTGTTTTCAGCTCATCCCT
 
. : . : . : . : . : . :
JMSF034L18+ TGGGAACAAATGAAAATTGTATGGGGAAGCAATGAGTTTGGACTCCCTGAGAGAGAAAGG
JMSF035L17+ TGGGAACAAATGAAAATTGTATGGGGAAGCAATGAGTTTGGACTCCCTGAGAGAGAAAGG
                      ____________________________________________________________
consensus TGGGAACAAATGAAAATTGTATGGGGAAGCAATGAGTTTGGACTCCCTGAGAGAGAAAGG
 
. : . : . : . : . : . :
JMSF034L18+ GCAAACGGCGAATTGAAGAATCTGGTACCGTTCGGCAGCGCGCTTAGCTTTGAGATAAGC
JMSF035L17+ GCAAACGGCGAATTGAAGAATCTGGTACCGTTCGGCAGCGCGCTTAGCTTTGAGATAAGC
                      ____________________________________________________________
consensus GCAAACGGCGAATTGAAGAATCTGGTACCGTTCGGCAGCGCGCTTAGCTTTGAGATAAGC
 
. : . : . : . : . : . :
JMSF034L18+ GATTTCGGCGGTGTCGAAGGGGAGCAGCCGTTGCCAAGGGGAAGAGTAAGCGCCGGTCGT
JMSF035L17+ GATTTCGGCGGTGTCGAAGGGGAGCAGCCGTTGCCAAGGGGAAGAGTAAGCGCCGGTCGT
                      ____________________________________________________________
consensus GATTTCGGCGGTGTCGAAGGGGAGCAGCCGTTGCCAAGGGGAAGAGTAAGCGCCGGTCGT
 
. : . : . : . : . : . :
JMSF034L18+ CTGTAACGACACGGCGATGAAATCGGACTCGGTTATGCGGGTCTCGATATCGTTCAGTGC
JMSF035L17+ CTGTAACGACACGGCGATGAAATCGGACTCGGTTATGCGGGTCTCGATATCGTTCAGTGC
                      ____________________________________________________________
consensus CTGTAACGACACGGCGATGAAATCGGACTCGGTTATGCGGGTCTCGATATCGTTCAGTGC
 
. : . : . : . : . : . :
JMSF034L18+ CTCGGAGAAGTTGGACTTGGTAACTTGTTTGATGCCCCATTTGCCGTAGTTGCTACCGCC
JMSF035L17+ CTCGGAGAAGTTGGACTTGGTAACTTGTTTGATGCCCCATTTGCCGTAGTTGCTACCGCC
                      ____________________________________________________________
consensus CTCGGAGAAGTTGGACTTGGTAACTTGTTTGATGCCCCATTTGCCGTAGTTGCTACCGCC
 
. : . : . : . : . : . :
JMSF034L18+ GGAGTTTGGCCGGAAAGCTGTTTCGGAAATAGCAGTGCAAAATAAGCGTCTCTGTAACAT
JMSF035L17+ GGAGTTTGGCCGGAAAGCTGTTTCGGAAATAGCAGTGCAAAATAAGCGTCTCTGTAACAT
                      ____________________________________________________________
consensus GGAGTTTGGCCGGAAAGCTGTTTCGGAAATAGCAGTGCAAAATAAGCGTCTCTGTAACAT
 
. : . : . : . : . : . :
JMSF034L18+ TGAACACAGAATCGAAACAGAGCTGCAGTTCAGAGC
JMSF035L17+ TGAACACAGAATCGAAACAGAGCTGCAGTTCAGAGCGGAGACGAAAGGGAAGAGTTGGTC
                      ____________________________________________________________
consensus TGAACACAGAATCGAAACAGAGCTGCAGTTCAGAGCGGAGACGAAAGGGAAGAGTTGGTC