Previous Contig 007036:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002B05Sequence490007036 (7)gb:AF297643_17840781e-49Cucumis melo mitochondrial processing peptidase beta subunit mRNA, complete cds;748008205 (6)gb:AF363285_17915237e-53Avicennia marina mitochondrial processing peptidase mRNA, complete cds; nuclear
JMFF003F05Sequence516007036 (7)gb:AF363285_17915232e-53Avicennia marina mitochondrial processing peptidase mRNA, complete cds; nuclear 679008205 (6)gb:AF363285_17915232e-61Avicennia marina mitochondrial processing peptidase mRNA, complete cds; nuclear
JMFF005C12Sequence498007036 (7)gb:AF297643_17840786e-51Cucumis melo mitochondrial processing peptidase beta subunit mRNA, complete cds;686008205 (6)gb:AF363285_17915237e-62Avicennia marina mitochondrial processing peptidase mRNA, complete cds; nuclear
JMFF036M01Sequence490007036 (7)gb:AF363285_17915236e-53Avicennia marina mitochondrial processing peptidase mRNA, complete cds; nuclear 749008205 (6)gb:AF363285_17915234e-56Avicennia marina mitochondrial processing peptidase mRNA, complete cds; nuclear
JMFF047L20Sequence604007036 (7)gb:AF297643_17840783e-63Cucumis melo mitochondrial processing peptidase beta subunit mRNA, complete cds;568008205 (6)gb:AF363285_17915231e-34Avicennia marina mitochondrial processing peptidase mRNA, complete cds; nuclear
JMFS085B08Sequence615007036 (7)gb:AF297643_17840781e-66Cucumis melo mitochondrial processing peptidase beta subunit mRNA, complete cds;
JMSF035L03Sequence699007036 (7)gb:AF297643_17840784e-77Cucumis melo mitochondrial processing peptidase beta subunit mRNA, complete cds;662008205 (6)gb:AF363285_17915237e-62Avicennia marina mitochondrial processing peptidase mRNA, complete cds; nuclear

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF035L03+ GAATCACATCTCGCTCCCTTTCGATTCGTTTCTGATCAA
                      ____________________________________________________________
consensus GAATCACATCTCGCTCCCTTTCGATTCGTTTCTGATCAA
 
. : . : . : . : . : . :
JMFS085B08+ ATATCCAAAGCCCTGGTGATATCTTTATCCA
JMFF047L20+ ATCCA
JMSF035L03+ ATTTCGAGTTCTGAATAATATCCGACAATATATCCAAAGCCCTGGTGATATCTTTATCCA
                      ____________________________________________________________
consensus ATTTCGAGTTCTGAATAATATCCGACAATATATCCAAAGCCCTGGTGATATCTTTATCCA
 
. : . : . : . : . : . :
JMFS085B08+ AGACTTTGGCATAGAACGTAGTTTGCTCCCTGGAAGTGTATGCATTTAGATGCCCTCCCA
JMFF047L20+ AGACTTTGGCATAGAACGTAGTTTGCTCCCTGGAAGTGTATGCATTTAGATGCCCTCCCA
JMSF035L03+ AGACTTTGGCATAGAACGTAGTTTGCTCCCTGGAAGTGTATGCATTTAGATGCCCTCCCA
                      ____________________________________________________________
consensus AGACTTTGGCATAGAACGTAGTTTGCTCCCTGGAAGTGTATGCATTTAGATGCCCTCCCA
 
. : . : . : . : . : . :
JMFS085B08+ TGTTCTCAATCTCCTCCTCTAACTCCCTAGCAGTCCGTCTCTCCGTGCCCTTGAAGATCA
JMFF047L20+ TGTTCTCAATCTCCTCCTCTAACTCCCTAGCAGTCCGTCTCTCCGTGCCCTTGAAGATCA
JMFF005C12+ TCCGTGCCCTTGAAGATCA
JMFF036M01+ CTAGCAGTCCGTCTCTCCGTGCCCTTGAAGATCA
JMFF002B05+ GTCTCTCCGTGCCCTTGAAGATCA
JMFF003F05+ TCCCTAGCAGTCCGTCTCTCCGTGCCCTTGAAGATCA
JMSF035L03+ TGTTCTCAATCTCCTCCTCTAACTCCCTAGCAGTCCGTCTCTCCGTGCCCTTGAAGATCA
                      ____________________________________________________________
consensus TGTTCTCAATCTCCTCCTCTAACTCCCTAGCAGTCCGTCTCTCCGTGCCCTTGAAGATCA
 
. : . : . : . : . : . :
JMFS085B08+ TGTGCTCGAGGAAATGAGCGGTGCCGTTAGTCTCCTCCGTCTCGAACCGAGAGCCGGCGT
JMFF047L20+ TGTGCTCGAGGAAATGAGCGGTGCCGTTAGTCTCCTCCGTCTCGAACCGAGAGCCGGCGT
JMFF005C12+ TGTGCTCGAGGAAATGAGCGGTGCCGTTAGTCTCCTCCGTCTCGAACCGAGAGCCGGCGT
JMFF036M01+ TGTGCTCGAGGAAATGAGCGGTGCCGTTAGTCTCCTCCGTCTCGAACCGAGAGCCGGCGT
JMFF002B05+ TGTGCTCGAGGAAATGAGCGGTGCCGTTAGTCTCCTCCGTCTCGAACCGAGAGCCGGCGT
JMFF003F05+ TGTGCTCGAGGAAATGAGCGGTGCCGTTAGTCTCCTCCGTCTCGAACCGAGAGCCGGCGT
JMSF035L03+ TGTGCTCGAGGAAATGAGCGGTGCCGTTAGTCTCCTCCGTCTCGAACCGAGAGCCGGCGT
                      ____________________________________________________________
consensus TGTGCTCGAGGAAATGAGCGGTGCCGTTAGTCTCCTCCGTCTCGAACCGAGAGCCGGCGT
 
. : . : . : . : . : . :
JMFS085B08+ CAATGAACACGCCGACGGTGGCAGTTTTAGCGGCGAGGTTGGACTCGGTGGCGACTCTTA
JMFF047L20+ CAATGAACACGCCGACGGTGGCAGTTTTAGCGGCGAGGTTGGACTCGGTGGCGACTCTTA
JMFF005C12+ CAATGAACACGCCGACGGTGGCAGTTTTAGCGGCGAGGTTGGACTCGGTGGCGACTCTTA
JMFF036M01+ CAATGAACACGCCGACGGTGGCAGTTTTAGCGGCGAGGTTGGACTCGGTGGCGACTCTTA
JMFF002B05+ CAATGAACACGCCGACGGTGGCAGTTTTAGCGGCGAGGTTGGACTCGGTGGCGACTCTTA
JMFF003F05+ CAATGAACACGCCGACGGTGGCAGTTTTAGCGGCGAGGTTGGACTCGGTGGCGACTCTTA
JMSF035L03+ CAATGAACACGCCGACGGTGGCAGTTTTAGCGGCGAGGTTGGACTCGGTGGCGACTCTTA
                      ____________________________________________________________
consensus CAATGAACACGCCGACGGTGGCAGTTTTAGCGGCGAGGTTGGACTCGGTGGCGACTCTTA
 
. : . : . : . : . : . :
JMFS085B08+ GTCCGTTCGGCAAAGTGGTGACGCGGGTAGCAGGGGCAGTGAGGATTGCAGTGTGGTCGG
JMFF047L20+ GTCCGTTCGGCAAAGTGGTGACGCGGGTAGCAGGGGCAGTGAGGATTGCAGTGTGGTCGG
JMFF005C12+ GTCCGTTCGGCAAAGTGGTGACGCGGGTAGCAGGGGCAGTGAGGATTGCAGTGTGGTCGG
JMFF036M01+ GTCCGTTCGGCAAAGTGGTGACGCGGGTAGCAGGGGCAGTGAGGATTGCAGTGTGGTCGG
JMFF002B05+ GTCCGTTCGGCAAAGTGGTGACGCGGGTAGCAGGGGCAGTGAGGATTGCAGTGTGGTCGG
JMFF003F05+ GTCCGTTCGGCAAAGTGGTGACGCGGGTAGCAGGGGCAGTGAGGATTGCAGTGTGGTCGG
JMSF035L03+ GTCCGTTCGGCAAAGTGGTGACGCGGGTAGCAGGGGCAGTGAGGATTGCAGTGTGGTCGG
                      ____________________________________________________________
consensus GTCCGTTCGGCAAAGTGGTGACGCGGGTAGCAGGGGCAGTGAGGATTGCAGTGTGGTCGG
 
. : . : . : . : . : . :
JMFS085B08+ CCAAAACTGGATGGGGGGAGTTGTATTGGAGAAAGCGCGAGTCGGGGTTTTCTAGCCGCT
JMFF047L20+ CCAAAACTGGATGGGGGGAGTTGTATTGGAGAAAGCGCGAGTCGGGGTTTTCTAGCCGCT
JMFF005C12+ CCAAAACTGGATGGGGGGAGTTGTATTGGAGAAAGCGCGAGTCGGGGTTTTCTAGCCGCT
JMFF036M01+ CCAAAACTGGATGGGGGGAGTTGTATTGGAGAAAGCGCGAGTCGGGGTTTTCTAGCCGCT
JMFF002B05+ CCAAAACTGGATGGGGGGAGTTGTATTGGAGAAAGCGCGAGTCGGGGTTTTCTAGCCGCT
JMFF003F05+ CCAAAACTGGATGGGGGGAGTTGTATTGGAGAAAGCGCGAGTCGGGGTTTTCTAGCCGCT
JMSF035L03+ CCAAAACTGGATGGGGGGAGTTGTATTGGAGAAAGCGCGAGTCGGGGTTTTCTAGCCGCT
                      ____________________________________________________________
consensus CCAAAACTGGATGGGGGGAGTTGTATTGGAGAAAGCGCGAGTCGGGGTTTTCTAGCCGCT
 
. : . : . : . : . : . :
JMFS085B08+ TCAGTTTATGTTTCACGGATTCGGCTAGGCGATCGTAGATCATGGCGGTTGGAGGCGGCG
JMFF047L20+ TCAGTTTATGTTTCACGGATTCGGCTAGGCGATCGTAGATCATGGCGGTTGGAGGCGGCG
JMFF005C12+ TCAGTTTATGTTTCACGGATTCGGCTAGGCGATCGTAGATCATGGCGGTTGGAGGCGGCG
JMFF036M01+ TCAGTTTATGTTTCACGGATTCGGCTAGGCGATCGTAGATCATGGCGGTTGGAGGCGGCG
JMFF002B05+ TCAGTTTATGTTTCACGGATTCGGCTAGGCGATCGTAGATCATGGCGGTTGGAGGCGGCG
JMFF003F05+ TCAGTTTATGTTTCACGGATTCGGCTAGGCGATCGTAGATCATGGCGGTTGGAGGCGGCG
JMSF035L03+ TCAGTTTATGTTTCACGGATTCGGCTAGGCGATCGTAGATCATGGCGGTTGGAGGCGGCG
                      ____________________________________________________________
consensus TCAGTTTATGTTTCACGGATTCGGCTAGGCGATCGTAGATCATGGCGGTTGGAGGCGGCG
 
. : . : . : . : . : . :
JMFS085B08+ GCGACGGCGCCAGAGTTCCATTTGCGGCGGCTGCAACGGCTGCGGAGGATGAGGAAAAAG
JMFF047L20+ GCGACGGCGCCAGAGTTCCATTTGCGGCGGCTGCAACGGCTGCGGAGGATGAGGAAAAAG
JMFF005C12+ GCGACGGCGCCAGAGTTCCATTTGCGGCGGCTGCAACGGCTGCGGAGGATGAGGAAAAAG
JMFF036M01+ GCGACGGCGCCAGAGTTCCATTTGCGGCGGCTGCAACGGCTGCGGAGGATGAGGAAAAAG
JMFF002B05+ GCGACGGCGCCAGAGTTCCATTTGCGGCGGCTGCAACGGCTGCGGAGGATGAGGAAAAAG
JMFF003F05+ GCGACGGCGCCAGAGTTCCATTTGCGGCGGCTGCAACGGCTGCGGAGGATGAGGAAAAAG
JMSF035L03+ GCGACGGCGCCAGAGTTCCATTTGCGGCGGCTGCAACGGCTGCGGAGGATGAGGAAAAAG
                      ____________________________________________________________
consensus GCGACGGCGCCAGAGTTCCATTTGCGGCGGCTGCAACGGCTGCGGAGGATGAGGAAAAAG
 
. : . : . : . : . : . :
JMFS085B08+ GCTTGCCGCATCGGGAAGCGATAGTTCTCCTCGACCGACGGGCTAGATTTAGGAGCTGCC
JMFF047L20+ GCTTGCCGCATCGGGAAGCGATAGTTCTCCTCGACCGACGGGCTAGATTTAGGAGCTGCC
JMFF005C12+ GCTTGCCGCATCGGGAAGCGATAGTTCTCCTCGACCGACGGGCTAGATTTAGGAGCTGCC
JMFF036M01+ GCTTGCCGCATCGGGAAGCGATAGTTCTCCTCGACCGACGGGCTAGATTTAGGAGCTGCC
JMFF002B05+ GCTTGCCGCGTCGGGAAGCGATAGTTCTCCTCGACCGACGGGCTAGATTTAGGAGCTGCC
JMFF003F05+ GCTTGCCGCATCGGGAAGCGATAGTTCTCCTCGACCGACGGGCTAGATTTAGGAGCTGCC
JMSF035L03+ GCTTGCCGCATCGGGAAGCGATAGTTCTCCTCGACCGACGGGCTAGATTTAGGAGCTGCC
                      ____________________________________________________________
consensus GCTTGCCGCATCGGGAAGCGATAGTTCTCCTCGACCGACGGGCTAGATTTAGGAGCTGCC
 
. : . : . : . : . : . :
JMFS085B08+ GGATCGCCATGGCTGCTGGCTGCGATTCGACTCGCTAGGGTTTG
JMFF047L20+ GGATCGCCATGGCTGCTGGCTGCGATTCGACTCGCTAGGGTTTGGTGAGAAAATGGTGT
JMFF005C12+ GGATCGCCATGGCTGCTGGCTGCGATTCGACTCGCTAGGGTTTGGTGAGAAAATGGTGT
JMFF036M01+ GGATCGCCATGGCTGCTGGCTGCGATTCGACTCGCT
JMFF002B05+ GGATCGCCATGGCTGCTGGCTGCGATTCGACTCGCTAGGGTTTGGT
JMFF003F05+ GGATCGCCATGGCTGCTGGCTGCGATTCGACTCGCTAGGGTTTGGTGAGAAAATGGTGT
JMSF035L03+ GGATCGCCATGGCTGCTGGCTGCGATTCGACTCGCTAGGGTTTGGTGAGAAAATGGTGTC
                      ____________________________________________________________
consensus GGATCGCCATGGCTGCTGGCTGCGATTCGACTCGCTAGGGTTTGGTGAGAAAATGGTGTC