Previous Contig 007028:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017C14Sequence558007028 (8)pir|T50765|T507651e-50adhesion of calyx edges protein ACE [imported] - Arabidopsis thaliana>gb:AE00517693010714 (7)pir|T50764|T507647e-63adhesion of calyx edges protein ACE [imported] - Arabidopsis thaliana>gb:AB02750
JMFF045B03Sequence604007028 (8)pir|T50765|T507651e-49adhesion of calyx edges protein ACE [imported] - Arabidopsis thaliana>gb:AE00517496010714 (7)gb:AP005388_18508792e-34Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMFF045B13Sequence642007028 (8)pir|T50765|T507652e-43adhesion of calyx edges protein ACE [imported] - Arabidopsis thaliana>gb:AE00517595010714 (7)pir|T50764|T507642e-51adhesion of calyx edges protein ACE [imported] - Arabidopsis thaliana>gb:AB02750
JMFF047D11Sequence638007028 (8)pir|T50765|T507658e-52adhesion of calyx edges protein ACE [imported] - Arabidopsis thaliana>gb:AE00517626010714 (7)gb:AP005388_18508792e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMFF049E07Sequence548007028 (8)pir|T50765|T507655e-29adhesion of calyx edges protein ACE [imported] - Arabidopsis thaliana>gb:AE00517549010714 (7)pir|T50764|T507641e-49adhesion of calyx edges protein ACE [imported] - Arabidopsis thaliana>gb:AB02750
JMFF051J15Sequence612007028 (8)pir|T50765|T507651e-40adhesion of calyx edges protein ACE [imported] - Arabidopsis thaliana>gb:AE00517600010714 (7)gb:AP005388_18508791e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMFS078G07Sequence625007028 (8)pir|T50765|T507658e-41adhesion of calyx edges protein ACE [imported] - Arabidopsis thaliana>gb:AE00517
JMSF035J01Sequence658007028 (8)pir|T50765|T507656e-42adhesion of calyx edges protein ACE [imported] - Arabidopsis thaliana>gb:AE00517

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF045B03+ ACCCATGGGTAGGATTCATTCACCAGCTTTGCATCCC--
JMFF051J15+ GGATTCATTCACCAGCT-TGCATCCCCA
JMFF017C14+ ACCCATGGGTAGGATTCATTCACCAGCTTTGCATCCC--
JMFF047D11+ AACTATCTGCTTCTCTACCCATGGGTAGGATTCATTCACCAGCTNTGCATCCC--
JMFF045B13+ C--
                      ____________________________________________________________
consensus AACTATCTGCTTCTCTACCCATGGGTAGGATTCATTCACCAGCTTTGCATCCC--
 
. : . : . : . : . : . :
JMFF045B03+ ACCCTGCTTTCTGGATATAACTTGGGCTAGCTCTAGTGTAGAAGCCGGCGTTGATGCAAG
JMFF051J15+ NCCCTGCTTTCTGNATATAACTGGGGCTAGCTCTAGTGTAGAAGCCGGCGTGNATGCAAG
JMFF017C14+ ACCCTGCTTTCTTGATATAACTTGGGCTAGCTCTAGTGTAGAAGCCGGCGTTGATGCAAG
JMFF047D11+ ACCCTGCTTTCTTGATATAACTTGGGCTAGCTCTAGTGTAGAAGCCGGCGTTGATGCAAG
JMFF045B13+ ACCCTGCTTTCTTGATATAACTTGGGCTAGCTCTAGTGTAGAAGCCGGCGTTGATGCAAG
JMFS078G07+ TGATATAACTTGGGCTAGCTCTAGTGTAGAAGCCGGCGTTGATGCAAG
JMSF035J01+ CCTGCTTTCTTGATATAACTTGGGCTAGCTCTAGTGTAGAAGCCGGCGTTGATGCAAG
                      ____________________________________________________________
consensus ACCCTGCTTTCTTGATATAACTTGGGCTAGCTCTAGTGTAGAAGCCGGCGTTGATGCAAG
 
. : . : . : . : . : . :
JMFF045B03+ TCCCGCCGCCGAGAACTCTGGCCCGGGAATTGAAGACGCCGTCGGTGGAGACGAAGACCT
JMFF051J15+ TCCCGCCGCCGAGAACTCTGGCCCGGGAATTGAAGACGCCGTCGGTGGAGACGAAGACCT
JMFF017C14+ TCCCGCCGCCGAGAACTCTGGCCCGGGAATTGAAGACGCCGTCGGTGGAGACGAAGACCT
JMFF047D11+ TCCCGCCGCCGAGAACTCTGGCCCGGGAATTGAAGACGCCGTCGGTGGAGACGAAGACCT
JMFF049E07+ GGCCCGGGAATGAAAGACGCCGTCGGTGGAGACGAAGACCT
JMFF045B13+ TCCCGCCGCCGAGAACTCTGGCCCGGGAATTGAAGACGCCGTCGGTGGAGACGAAGACCT
JMFS078G07+ TCCCGCCGCCGAGAACTCTGGCCCGGGAATTGAAGACGCCGTCGGTGGAGACGAAGACCT
JMSF035J01+ TCCCGCCGCCGAGAACTCTGGCCCGGGAATTGAAGACGCCGTCGGTGGAGATGAAGACCT
                      ____________________________________________________________
consensus TCCCGCCGCCGAGAACTCTGGCCCGGGAATTGAAGACGCCGTCGGTGGAGACGAAGACCT
 
. : . : . : . : . : . :
JMFF045B03+ GTGAGGCGGACGACGGTGAGGTGTCGGCCAAGGTGATGTGGAAGTTCTCCATGAACGACA
JMFF051J15+ GTGAGGCGGACGACGGCGAGGTGTCGGCCAAGGTGATGTGGAAGTTCTCCATGAACGACA
JMFF017C14+ GTGAGGCGGACGACGGCGAGGTGTCGGCCAAGGTGATGTGGAAGTTCTCCATGAACGACA
JMFF047D11+ GTGAGGCGGACGACGGCGAGGTGTCGGCCAAGGTGATGTGGAAGTTCTCCATGAACGACA
JMFF049E07+ GTGAGGCGGACGACGGCGAGGTGTCGGCCAAGGTGATGTGGAAGTTCTCCATGAACGACA
JMFF045B13+ GTGAGGCGGACGACGGCGAGGTGTCGGCCAAGGTGATGTGGAAGTTCTCCATGAACGACA
JMFS078G07+ GTGAGGCGGACGACGGCGAGGTGTCGGCCAAGGTGATGTGGAAGTTCTCCATGAACGACA
JMSF035J01+ GTGAGGCGGACGACGGCGAGGTGTCGGCCAAGGTGATGTGGAAGTTCTCCATGAACGACA
                      ____________________________________________________________
consensus GTGAGGCGGACGACGGCGAGGTGTCGGCCAAGGTGATGTGGAAGTTCTCCATGAACGACA
 
. : . : . : . : . : . :
JMFF045B03+ CGTTTGAGTTGGCAAACGGCACGCCGCCTCTCTCCAGCAGCAGAACACTGAAGTTCTGCG
JMFF051J15+ CGTTTGAGTTGGCAAACGGCACGCCGCCTCTCTCCAGCAGCAGAACACTGAAGTTCTGCG
JMFF017C14+ CGTTTGAGTTGGCAAACGGCACGCCGCCTCTCTCCAGCAGCAGAACACTGAAGTTCTGCG
JMFF047D11+ CGTTTGAGTTGGCAAACGGCACGCCGCCTCTCTCCAGCAGCAGAACACTGAAGTTCTGCG
JMFF049E07+ CGTTGAGTTTGGCAAACGGCACGCCGCCTCTCTCCAGCAGCAGAACACTGAAGTTCTGCG
JMFF045B13+ CGTTTGAGTTGGCAAACGGCACGCCGCCTCTCTCCAGCAGCAGAACACTGAAGTTCTGCG
JMFS078G07+ CGTTTGAGTTGGCAAACGGCACGCCGCCTCTCTCCAGCAGCAGAACACTGAAGTTCTGCG
JMSF035J01+ CGTTTGAGTTGGCAAACGGCACGCCGCCTCTCTCCAGCAGCAGAACACTGAAGTTCTGCG
                      ____________________________________________________________
consensus CGTTTGAGTTGGCAAACGGCACGCCGCCTCTCTCCAGCAGCAGAACACTGAAGTTCTGCG
 
. : . : . : . : . : . :
JMFF045B03+ ACAGCGTGGCCGCCAATGGGCACCCCGCCGTGCCGCCGCCCACTATAATGTAATCATAAT
JMFF051J15+ ACAGCGTGGCCGCCAATGGGCACCCCGCCGTGCCGCCGCCCACTATAATGTAATCATAAT
JMFF017C14+ ACAGCGTGGCCGCCAATGGGCACCCCGCCGTGCCGCCGCCCACTATAATGTAATCATAAT
JMFF047D11+ ACAGCGTGGCCGCCAATGGGCACCCCGCCGTGCCGCCGCCCACTATAATGTAATCATAAT
JMFF049E07+ ACAGCGTGGCCGCCAATGGGCACCCCGCCGTGCCGCCGCCCACTATAATGTAATCATAAT
JMFF045B13+ ACAGCGTGGCCGCCAATGGGCACCCCGCCGTGCCGCCGCCCACTATAATGTAATCATAAT
JMFS078G07+ ACAGCGTGGCCGCCAATGGGCACCCCGCCGTGCCGCCGCCCACTATAATGTAATCATAAT
JMSF035J01+ ACAGCGTGGCCGCCAATGGGCACCCCGCCGTGCCGCCGCCCACTATAATGTAATCATAAT
                      ____________________________________________________________
consensus ACAGCGTGGCCGCCAATGGGCACCCCGCCGTGCCGCCGCCCACTATAATGTAATCATAAT
 
. : . : . : . : . : . :
JMFF045B03+ CCCTGTTCCCGCCGCCACCCACGGCGGCGTTTGACGACGACGATGACGAGGAGGAAGCGG
JMFF051J15+ CCCTGTTCCCGCCGCCACCCACGGCGGCGTTTGACGACGACGATGACGAGGAGGAAGCGG
JMFF017C14+ CCCTGTTCCCGCCGCCACCCACGGCGGCGTTTGACGACGACGATGACGAGGAGGAAGCGG
JMFF047D11+ CCCTGTTCCCGCCGCCACCCACGGCGGCGTTTGACGACGACGATGACGAGGAGGAAGCGG
JMFF049E07+ CCCTGTTCCCGCCGCCACCCACGGCGGCGTTTGACGACGACGATGACGAGGAGGAAGCGG
JMFF045B13+ CCCTGTTCCCGCCGCCACCCACGGCGGCGTTTGACGACGACGATGACGAGGAGGAAGCGG
JMFS078G07+ CCCTGTTCCCGCCGCCACCCACGGCGGCGTTTGACGACGACGATGACGAGGAGGAAGCGG
JMSF035J01+ CCCTGTTCCCGCCGCCACCCACGGCGGCGTTTGACGACGACGATGACGAGGAGGAAGCGG
                      ____________________________________________________________
consensus CCCTGTTCCCGCCGCCACCCACGGCGGCGTTTGACGACGACGATGACGAGGAGGAAGCGG
 
. : . : . : . : . : . :
JMFF045B03+ CGGCGGAGTACGAGCTGGCATATTTTATGAATGGGTATTTATCATTCCAGAAATAATTAT
JMFF051J15+ CGGCGGAGTACGAGCTGGCATATTTTATGAATGGGTATTTATCATTCCAGAAATAATTAT
JMFF017C14+ CGGCGGAGTACGAGCTGGCATATTTTATGAATGGGTATTTATCATTCCAGAAATAATTAT
JMFF047D11+ CGGCGGAGTACGAGCTGGCATATTTTATGAATGGGTATTTATCATTCCAGAAATAATTAT
JMFF049E07+ CGGCGGAGTACGAGCTGGCATATTTTATGAATGGGTATTTATCATTCCAGAAATAATTAT
JMFF045B13+ CGGCGGAGTACGAGCTGGCATATTTTATGAATGGGTATTTATCATTCCAGAAATAATTAT
JMFS078G07+ CGGCGGAGTACGAGCTGGCATATTTTATGAATGGGTATTTATCATTCCAGAAATAATTAT
JMSF035J01+ CGGCGGAGTACGAGCTGGCATATTTTATGAATGGGTATTTATCATTCCAGAAATAATTAT
                      ____________________________________________________________
consensus CGGCGGAGTACGAGCTGGCATATTTTATGAATGGGTATTTATCATTCCAGAAATAATTAT
 
. : . : . : . : . : . :
JMFF045B03+ TATTCTCTCTCCCTCGGCAAGAAGTGATGGCGCATAGAAGCGAGGAGACCAGAAGAAGTA
JMFF051J15+ TATTCTCTCTCCCTCGGCAAGAAGTGATGGCGCATAGAAGCGAGGAGACCAGAAGAAGTA
JMFF017C14+ TATTCTCTCTCCCTCGGCAAGAAGTGATGGCGCATAGAAGCGAGGAGACCAGAAGAAGTA
JMFF047D11+ TATTCTCTCTCCCTCGGCAAGAAGTGATGGCGCATAGAAGCGAGGAGACCAGAAGAAGTA
JMFF049E07+ TATTCTCTCTCCCTCGGCAAGAAGTGATGGCGCATAGAAGCGAGGAGACCAGAAGAAGTA
JMFF045B13+ TATTCTCTCTCCCTCGGCAAGAAGTGATGGCGCATAGAAGCGAGGAGACCAGAAGAAGTA
JMFS078G07+ TATTCTCTCTCCCTCGGCAAGAAGTGATGGCGCATAGAAGCGAGGAGACCAGAAGAAGTA
JMSF035J01+ TATTCTCTCTCCCTCGGCAAGAAGTGATGGCGCATAGAAGCGAGGAGACCAGAAGAAGTA
                      ____________________________________________________________
consensus TATTCTCTCTCCCTCGGCAAGAAGTGATGGCGCATAGAAGCGAGGAGACCAGAAGAAGTA
 
. : . : . : . : . : . :
JMFF045B03+ AAAGAGGATGCCCAACCGCAGCCATGGACGACAGAACCCACAGACAACCTCAGAAAACAC
JMFF051J15+ AAAGAGGATGCCCAACCGCAGCCATGGACGACAGAACCCACAGACAACCTCAGAAAACAC
JMFF017C14+ AAAGAGGATGCCCAACCGCAGCCATGGACGACAGAACCC
JMFF047D11+ AAAGAGGATGCCCAACCGCAGCCATGGACGACAGAACCCACAGACAACCTCAGAAAACAC
JMFF049E07+ AAAGAGGATGCCCAACCGCAGCCATGGACGACAGAACCCACAGACAACCTCAGAAAACAC
JMFF045B13+ AAAGAGGATGCCCAACCGCAGCCATGGACGACAGAACCCACAGACAACCTCAGAAAACAC
JMFS078G07+ AAAGAGGATGCCCAACCGCAGCCATGGACGACAGAACCCACAGACAACCTCAGAAAACAC
JMSF035J01+ AAAGAGGATGCCCAACCGCAGCCATGGACGACAGAACCCACAGACAACCTCAGAAAACAC
                      ____________________________________________________________
consensus AAAGAGGATGCCCAACCGCAGCCATGGACGACAGAACCCACAGACAACCTCAGAAAACAC
 
. : . : . : . : . : . :
JMFF045B03+ CAATCTATCTCTCTCTCTTCAAAGTGG
JMFF051J15+ CAATCTATCTCTCTCTCTTCAAAGTGGCTTACGTTGGTTGGCCTT
JMFF047D11+ CAATCTATCTCTCTCTCTTCAAAGTGGCTTACGTTGGTTGGCCTT
JMFF049E07+ CAATCTATCTCTCTCTCTTGTAAGTGGCTTACGTTGGTTGGCCTTGTTTTCTCGTGTATC
JMFF045B13+ CAATCTATCTCTCTCTCTTCAAAGTGGCTTACGTTGGTTGGCCTTGTTTTCTCGTGTATC
JMFS078G07+ CAATCTATCTCTCTCTCTTCAAAGTGGCTTACGTTGGTTGGCCTTGTTTTCTCGTGTATC
JMSF035J01+ CAATCTATCTCTCTCTCTTCAAAGTGGCTTACGTTGGTTGGCCTTGTTTTCTCGTGTATC
                      ____________________________________________________________
consensus CAATCTATCTCTCTCTCTTCAAAGTGGCTTACGTTGGTTGGCCTTGTTTTCTCGTGTATC
 
. : . : . : . : . : . :
JMFF049E07+ TAATTTTCATACATATATACACACACC
JMFF045B13+ TAATTTTCATACATATATACACACACC
JMFS078G07+ TAATTTTCATACATATATACACACACCCTCTAATGTT
JMSF035J01+ TAATTTTCATACATATATACACACACCCTCTAATGTTAGTTGAAACTCGAGTTATATACC
                      ____________________________________________________________
consensus TAATTTTCATACATATATACACACACCCTCTAATGTTAGTTGAAACTCGAGTTATATACC