Previous Contig 007025:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015J20Sequence532007025 (2)gb:AY123847_15800566e-35Nicotiana tabacum glutamate/malate translocator (DiT2) mRNA, complete cds; nucle680008931 (4)gb:AY123847_15800562e-56Nicotiana tabacum glutamate/malate translocator (DiT2) mRNA, complete cds; nucle
JMSF035H14Sequence646007025 (2)gb:AY123847_15800561e-46Nicotiana tabacum glutamate/malate translocator (DiT2) mRNA, complete cds; nucle726008931 (4)gb:AY123847_15800563e-82Nicotiana tabacum glutamate/malate translocator (DiT2) mRNA, complete cds; nucle

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF035H14+ TCCACGAGCAAAGAAGAAAGAAATCACTATAAGCCAGATCACTTCA
                      ____________________________________________________________
consensus TCCACGAGCAAAGAAGAAAGAAATCACTATAAGCCAGATCACTTCA
 
. : . : . : . : . : . :
JMFF015J20+ CTCCAAAAGCAGCAGAGAAAGGTAATGTTTTAGTTAAAACTGAGGCTGCA
JMSF035H14+ TTGGTGAATGCTCCAAAAGCAGCAGAGAAAGGTAATGTTTTAGTTAAAACTGAGGCTGTA
                      ____________________________________________________________
consensus TTGGTGAATGCTCCAAAAGCAGCAGAGAAAGGTAATGTTTTAGTTAAAACTGAGGCTGTA
 
. : . : . : . : . : . :
JMFF015J20+ AGCCCCAGGAAAGCCCAAGCTCCGACCGGCAAAGGGCTGAGAACAAGGCCGGCGATGGTG
JMSF035H14+ AGCCCCAGGAAAGCCCAAGCTCCGACCGGCAAAGGGCTGAGAACAAGGCCGGCGATGGTG
                      ____________________________________________________________
consensus AGCCCCAGGAAAGCCCAAGCTCCGACCGGCAAAGGGCTGAGAACAAGGCCGGCGATGGTG
 
. : . : . : . : . : . :
JMFF015J20+ GAGAGGAAGATGGCGAGCAATTGCCATGCCTGGGGAGAAACCTCGGGAGGTTTGGGGATG
JMSF035H14+ GAGAGGAAGATGGCGAGCAATTGCCATGCCTGGGGAGAAACCTCGGGAGGTTTGGGGATG
                      ____________________________________________________________
consensus GAGAGGAAGATGGCGAGCAATTGCCATGCCTGGGGAGAAACCTCGGGAGGTTTGGGGATG
 
. : . : . : . : . : . :
JMFF015J20+ GCAAAGCGGACAAGAAGCCCAATAGCGACGGAGATTATCAAAGGAATGGGCTTCGCACCT
JMSF035H14+ GCAAAGCGGACAAGAAGCCCAATAGCGACGGAGATTATCAAAGGAATGGGCTTCGCACCT
                      ____________________________________________________________
consensus GCAAAGCGGACAAGAAGCCCAATAGCGACGGAGATTATCAAAGGAATGGGCTTCGCACCT
 
. : . : . : . : . : . :
JMFF015J20+ TGGGGTTTGGGAGTGAGCTGGGGGGTGGCAGTAGAGATCTTATCGCTGGCGGAGGAAGCT
JMSF035H14+ TGGGGTTTGGGAGTGAGCTGGGGGGTGGCAGTAGAGATCTTATCGCTGGCGGAGGAAGCT
                      ____________________________________________________________
consensus TGGGGTTTGGGAGTGAGCTGGGGGGTGGCAGTAGAGATCTTATCGCTGGCGGAGGAAGCT
 
. : . : . : . : . : . :
JMFF015J20+ CGGGTAATGAGTGGCGTAGGTTTCGAGATGGGTTTGGAAAGCGGGTTGAAGAGGAAAAGT
JMSF035H14+ CGGGTAATGAGTGGCGTAGGTTTCGAGATGGGTTTGGAAAGCGGGTTGAAGAGGAAAAGT
                      ____________________________________________________________
consensus CGGGTAATGAGTGGCGTAGGTTTCGAGATGGGTTTGGAAAGCGGGTTGAAGAGGAAAAGT
 
. : . : . : . : . : . :
JMFF015J20+ TTGGAATTCAGAAGCGAGAATTTGGGCGAGGAGATGGGGCGGAGAGCGAGAGTTGCAGTG
JMSF035H14+ TTGGAATTCAGGAGCGAGAATTTGGGCGAGGAGATGGGGCGGAGAGCGAGAGTTGCAGTG
                      ____________________________________________________________
consensus TTGGAATTCAGGAGCGAGAATTTGGGCGAGGAGATGGGGCGGAGAGCGAGAGTTGCAGTG
 
. : . : . : . : . : . :
JMFF015J20+ ACGGGGGAAATGGAGGTGCGTGATCGGAGGCGGGGGAAGGAGCGGTTAGAGAAGGAAGTT
JMSF035H14+ ACGGGGGAAATGGAGGTGCGTGATCGGAGGCGGGGGAAGGAGCGGTTAGAGAAGGAAGTT
                      ____________________________________________________________
consensus ACGGGGGAAATGGAGGTGCGTGATCGGAGGCGGGGGAAGGAGCGGTTAGAGAAGGAAGTT
 
. : . : . : . : . : . :
JMFF015J20+ GTGGCGGAGGTGGCCGACGATGGAGAGTAGAGTGCCAAACTCGCCATTTTTCTTTCTGTT
JMSF035H14+ GTGGCGGAGGTGGCCGACGATGGAGAGTAGAGTGCCAAACTCGCCATTTTTCTTTCTGTT
                      ____________________________________________________________
consensus GTGGCGGAGGTGGCCGACGATGGAGAGTAGAGTGCCAAACTCGCCATTTTTCTTTCTGTT
 
. : . : . : . : . : . :
JMFF015J20+ GT
JMSF035H14+ GTGGAGATAGAAGTGAAGGAAGAGCGGTGGGTTTTATTCGGCAAAAAGGCGGAAACTACC
                      ____________________________________________________________
consensus GTGGAGATAGAAGTGAAGGAAGAGCGGTGGGTTTTATTCGGCAAAAAGGCGGAAACTACC