Previous Contig 007022:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF035G16Sequence640007022 (2)gb:AP005808_18582212e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN599007022 (2)gb:AP005808_18582212e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF035G16+ GACTTCTCTTCAGTCCTCTCGATTTCAATCCATCGGAGAT
JMSF035G16- GACTTCTCTTCAGTCCTCTCGATTTCAATCCATCGGAGAT
                      ____________________________________________________________
consensus GACTTCTCTTCAGTCCTCTCGATTTCAATCCATCGGAGAT
 
. : . : . : . : . : . :
rJMSF035G16+ AGAAGGCGGTCAGCGGCCACAAGTTCTGCTTATTATCTCTAATGGATGCCATGGACCACA
JMSF035G16- AGAAGGCGGTCAGCGGCCACAAGTTCTGCTTATTATCTCTAATGGATGCCATGGACCACA
                      ____________________________________________________________
consensus AGAAGGCGGTCAGCGGCCACAAGTTCTGCTTATTATCTCTAATGGATGCCATGGACCACA
 
. : . : . : . : . : . :
rJMSF035G16+ AAGATGAGGTGAAAAATGCAGACAGCATGCAGCAAGTAAAAGAGAGTACATATATTCAGA
JMSF035G16- AAGATGAGGTGAAAAATGCAGACAGCATGCAGCAAGTAAAAGAGAGTACATATATTCAGA
                      ____________________________________________________________
consensus AAGATGAGGTGAAAAATGCAGACAGCATGCAGCAAGTAAAAGAGAGTACATATATTCAGA
 
. : . : . : . : . : . :
rJMSF035G16+ TAAAAGTTCTGTTCTTTGCTCGTGCTAGAGACCTTACAGGCTTGGACGATATGCCTCTGG
JMSF035G16- TAAAAGTTCTGTTCTTTGCTCGTGCTAGAGACCTTACAGGCTTGGACGATATGCCTCTGG
                      ____________________________________________________________
consensus TAAAAGTTCTGTTCTTTGCTCGTGCTAGAGACCTTACAGGCTTGGACGATATGCCTCTGG
 
. : . : . : . : . : . :
rJMSF035G16+ AAGTTTTATCTGGCAGTACCGCCCAAGATTGCTTAGATAAGGTTATTGCCAAGTTTCCGG
JMSF035G16- AAGTTTTATCTGGCAGTACCGCCCAAGATTGCTTAGATAAGGTTATTGCCAAGTTTCCGG
                      ____________________________________________________________
consensus AAGTTTTATCTGGCAGTACCGCCCAAGATTGCTTAGATAAGGTTATTGCCAAGTTTCCGG
 
. : . : . : . : . : . :
rJMSF035G16+ GATTGCAAGAGATACGCAAATGCATGGTCCTTGCCTTGAACTTGGAGTACACCCCGGAAT
JMSF035G16- GATTGCAAGAGATACGCAAATGCATGGTCCTTGCCTTGAACTTGGAGTACACCCCGGAAT
                      ____________________________________________________________
consensus GATTGCAAGAGATACGCAAATGCATGGTCCTTGCCTTGAACTTGGAGTACACCCCGGAAT
 
. : . : . : . : . : . :
rJMSF035G16+ CTACAGTCGTCAAAGATAGAGATGAGCTCGCCATTATCCCTCCTATAAGTGGAGGTTAGA
JMSF035G16- CTACAGTCGTCAAAGATAGAGATGAGCTCGCCATTATCCCTCCTATAAGTGGAGGTTAGA
                      ____________________________________________________________
consensus CTACAGTCGTCAAAGATAGAGATGAGCTCGCCATTATCCCTCCTATAAGTGGAGGTTAGA
 
. : . : . : . : . : . :
rJMSF035G16+ CATTCCAAGCCCCCCCTATATATTGTAAATGTTTGTAATGAAGGCTCTGGAAGTTACACA
JMSF035G16- CATTCCAAGCCCCCCCTATATATTGTAAATGTTTGTAATGAAGGCTCTGGAAGTTACACA
                      ____________________________________________________________
consensus CATTCCAAGCCCCCCCTATATATTGTAAATGTTTGTAATGAAGGCTCTGGAAGTTACACA
 
. : . : . : . : . : . :
rJMSF035G16+ TTTTGGTAGCATCAATCATACAGATTGCTACAATTATAATAAGTGCCATCTGCAACAAAA
JMSF035G16- TTTTGGTAGCATCAATCATACAGATTGCTACAATTATAATAAGTGCCATCTGCAACAAAA
                      ____________________________________________________________
consensus TTTTGGTAGCATCAATCATACAGATTGCTACAATTATAATAAGTGCCATCTGCAACAAAA
 
. : . : . : . : . : . :
rJMSF035G16+ CTCGACCATGCAGTTGATATGTATGTTGTTTCTTGACAGTATAATATTTCTCTTTTCCCT
JMSF035G16- CTCGACCATGCAGTTGATATGTATGTTGTTTCTTGACAGTATAATATTTCTCTTTTCCCT
                      ____________________________________________________________
consensus CTCGACCATGCAGTTGATATGTATGTTGTTTCTTGACAGTATAATATTTCTCTTTTCCCT
 
. : . : . : . : . : . :
rJMSF035G16+ ATCTCCATCTGTAATATCG
JMSF035G16- ATCTCCATCTGTAATATCGCCAACGTTGAGCTGATGAAATCATATGAATTATTATTAAAA
                      ____________________________________________________________
consensus ATCTCCATCTGTAATATCGCCAACGTTGAGCTGATGAAATCATATGAATTATTATTAAAA