Previous Contig 007016:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004E10Sequence549007016 (2)gb:AY738711_16261062e-68Digitalis ferruginea progesterone 5-beta-reductase gene, complete cds.748008318 (2)gb:AY574950_16158802e-73Digitalis lanata progesterone 5-beta-reductase mRNA, complete cds.>gb:AY585867_1
JMSF035F10Sequence658007016 (2)gb:AY585865_16163266e-81Digitalis grandiflora progesterone 5-beta-reductase gene, complete cds.700008318 (2)gb:AY574950_16158807e-66Digitalis lanata progesterone 5-beta-reductase mRNA, complete cds.>gb:AY585867_1

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF035F10+ TTACCTCGTCAAACAGAATATCCTCAAGAGTGTAGTAAAAGTTGGGAGATTCTAATCT
                      ____________________________________________________________
consensus TTACCTCGTCAAACAGAATATCCTCAAGAGTGTAGTAAAAGTTGGGAGATTCTAATCT
 
. : . : . : . : . : . :
JMSF035F10+ GGGCAAATCCTCGTGGTGGGGGGTGTCGTGGGCTACTTTTCCGAACACTTGAAACGCACC
                      ____________________________________________________________
consensus GGGCAAATCCTCGTGGTGGGGGGTGTCGTGGGCTACTTTTCCGAACACTTGAAACGCACC
 
. : . : . : . : . : . :
JMFF004E10+ GTTTGCAGGCAGATATGCTTCAAATCTGGAGAATTTGGGAT
JMSF035F10+ GAAATAGTGTTTCTTCCCCGTTTGCAGGCAGATATGCTTCAAATCTGGAGAATTTGGGAT
                      ____________________________________________________________
consensus GAAATAGTGTTTCTTCCCCGTTTGCAGGCAGATATGCTTCAAATCTGGAGAATTTGGGAT
 
. : . : . : . : . : . :
JMFF004E10+ TACCGCATTCAACACATTCCTCAACATTTTCCCGTTGGCTTCACAGTTTTCCAGTTCCGT
JMSF035F10+ TACCGCATTCAACACATTCCTCAACATTTTCCCGTTGGCTTCACAGTTTTCCAGTTCCGT
                      ____________________________________________________________
consensus TACCGCATTCAACACATTCCTCAACATTTTCCCGTTGGCTTCACAGTTTTCCAGTTCCGT
 
. : . : . : . : . : . :
JMFF004E10+ GGGTCGGTTTGCCCACGTCACGTAAAAAACATGCGTGACATCAGTCAGCACAGACAGCTT
JMSF035F10+ GGGTCGGTTTGCCCACGTCACGTAAAAAACATGCGTGACATCAGTCAGCACAGACAGCTT
                      ____________________________________________________________
consensus GGGTCGGTTTGCCCACGTCACGTAAAAAACATGCGTGACATCAGTCAGCACAGACAGCTT
 
. : . : . : . : . : . :
JMFF004E10+ GGAATGGGCATCTTCCTCGTCGGAAATATCGCACTGGATATACTCCATTGGATGATCAGA
JMSF035F10+ GGAATGGGCATCTTCCTCGTCGGAAATATCGCACTGGATATACTCCATTGGATGATCAGA
                      ____________________________________________________________
consensus GGAATGGGCATCTTCCTCGTCGGAAATATCGCACTGGATATACTCCATTGGATGATCAGA
 
. : . : . : . : . : . :
JMFF004E10+ GTTCCAGGCGGGTCTGGGGCGGCGGGCGACGCCGTAAACCTTCCATGGGCCGCCGGGTGT
JMSF035F10+ GTTCCAGGCGGGTCTGGGGCGGCGGGCGACGCCGTAAACCTTCCATGGGCCGCCGGGTGT
                      ____________________________________________________________
consensus GTTCCAGGCGGGTCTGGGGCGGCGGGCGACGCCGTAAACCTTCCATGGGCCGCCGGGTGT
 
. : . : . : . : . : . :
JMFF004E10+ GTCGGCGAGAGGGAGGATCTCGGCGAGGCTGTTGCCGACAATCCCGGTGACGCCCACGAT
JMSF035F10+ GTCGGCGAGAGGGAGGATCTCGGCGAGGCTGTTGCCGACAATCCCGGTGACGCCCACGAT
                      ____________________________________________________________
consensus GTCGGCGAGAGGGAGGATCTCGGCGAGGCTGTTGCCGACAATCCCGGTGACGCCCACGAT
 
. : . : . : . : . : . :
JMFF004E10+ TAGAGCCACGCTCTGGTGCTTAAGTGGCGCATCAAGATCATCATCTTCTTCAAACCTTTT
JMSF035F10+ TAGAGCCACGCTCTGGTGCTTAAGTGGCGCATCAAGATCATCATCTTCTTCAAACCTTTT
                      ____________________________________________________________
consensus TAGAGCCACGCTCTGGTGCTTAAGTGGCGCATCAAGATCATCATCTTCTTCAAACCTTTT
 
. : . : . : . : . : . :
JMFF004E10+ CCTGGCAGCGCCAATAGCTCCAGCTCGCCACCAGCTCATCTTTGGGATGATTTGCAGGGA
JMSF035F10+ CCTGGCAGCGCCAATAGCTCCAGCTCGCCACCAGCTCATCTTTGGGATGATTTGCAGGGA
                      ____________________________________________________________
consensus CCTGGCAGCGCCAATAGCTCCAGCTCGCCACCAGCTCATCTTTGGGATGATTTGCAGGGA
 
. : . : . : . : . : . :
JMFF004E10+ AAATATAATGGTGTCTTGTTCAGAGCAGAGAAATGGAAAGTTTCTGCAGGCTC
JMSF035F10+ AAATATAATGGTGTCTTGTTCAGAGCAGAGAAATGGAAAGTTTCTGCAGGCTCATAAACC
                      ____________________________________________________________
consensus AAATATAATGGTGTCTTGTTCAGAGCAGAGAAATGGAAAGTTTCTGCAGGCTCATAAACC