Previous Contig 007011:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF028F13Sequence657007011 (5)gb:AY039903_15604172e-23Arabidopsis thaliana AT3g18280/MIE15_7 mRNA, complete cds.>gb:AY077680_1567882 A618007011 (5)gb:AY039903_15604172e-23Arabidopsis thaliana AT3g18280/MIE15_7 mRNA, complete cds.>gb:AY077680_1567882 A
JMSF029F13Sequence278000016 (73)sp|P77214|CUSF_ECOLI1e-32Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es601007011 (5)gb:AY039903_15604172e-23Arabidopsis thaliana AT3g18280/MIE15_7 mRNA, complete cds.>gb:AY077680_1567882 A
JMSF035E01Sequence676007011 (5)gb:AY039903_15604172e-23Arabidopsis thaliana AT3g18280/MIE15_7 mRNA, complete cds.>gb:AY077680_1567882 A635007011 (5)gb:AY039903_15604172e-23Arabidopsis thaliana AT3g18280/MIE15_7 mRNA, complete cds.>gb:AY077680_1567882 A

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF035E01+ GATCAAAGCAAACACA
rJMSF028F13+ GATCAAAGCAAACACA
rJMSF029F13+ GATCAAAGCAAACACA
JMSF028F13- GATCAAAGCAAACACA
JMSF035E01- GATCAAAGCAAACACA
                      ____________________________________________________________
consensus GATCAAAGCAAACACA
 
. : . : . : . : . : . :
rJMSF035E01+ AACTCAAACAACACTCTAGCTTAGCTTGGCAATCCCCAATTAAGGCCAACCAAACAACAT
rJMSF028F13+ AACTCAAACAACACTCTAGCTTAGCTTGGCAATCCCCAATTAAGGCCAACCAAACAACAT
rJMSF029F13+ AACTCAAACAACACTCTAGCTTAGCTTGGCAATCCCCAATTAAGGCCAACCAAACAACAT
JMSF028F13- AACTCAAACAACACTCTAGCTTAGCTTGGCAATCCCCAATTAAGGCCAACCAAACAACAT
JMSF035E01- AACTCAAACAACACTCTAGCTTAGCTTGGCAATCCCCAATTAAGGCCAACCAAACAACAT
                      ____________________________________________________________
consensus AACTCAAACAACACTCTAGCTTAGCTTGGCAATCCCCAATTAAGGCCAACCAAACAACAT
 
. : . : . : . : . : . :
rJMSF035E01+ TGCAATGAGGAGCATAGCAATCTGCGCGATATTACTGGTGTTGGTTCTCGGGGCATCAAA
rJMSF028F13+ TGCAATGAGGAGCATAGCAATCTGCGCGATATTACTGGTGTTGGTTCTCGGGGCATCAAA
rJMSF029F13+ TGCAATGAGGAGCATAGCAATCTGCGCGATATTACTGGTGTTGGTTCTCGGGGCATCAAA
JMSF028F13- TGCAATGAGGAGCATAGCAATCTGCGCGATATTACTGGTGTTGGTTCTCGGGGCATCAAA
JMSF035E01- TGCAATGAGGAGCATAGCAATCTGCGCGATATTACTGGTGTTGGTTCTCGGGGCATCAAA
                      ____________________________________________________________
consensus TGCAATGAGGAGCATAGCAATCTGCGCGATATTACTGGTGTTGGTTCTCGGGGCATCAAA
 
. : . : . : . : . : . :
rJMSF035E01+ AGTTGAAGTGACTGAAGCGGTGACATGTAATCCCTTACAACTCAGTCCTTGTGCCACCGC
rJMSF028F13+ AGTTGAAGTGACTGAAGCGGTGACATGTAATCCCTTACAACTCAGTCCTTGTGCCACCGC
rJMSF029F13+ AGTTGAAGTGACTGAAGCGGTGACATGTAATCCCTTACAACTCAGTCCTTGTGCCACCGC
JMSF028F13- AGTTGAAGTGACTGAAGCGGTGACATGTAATCCCTTACAACTCAGTCCTTGTGCCACCGC
JMSF035E01- AGTTGAAGTGACTGAAGCGGTGACATGTAATCCCTTACAACTCAGTCCTTGTGCCACCGC
                      ____________________________________________________________
consensus AGTTGAAGTGACTGAAGCGGTGACATGTAATCCCTTACAACTCAGTCCTTGTGCCACCGC
 
. : . : . : . : . : . :
rJMSF035E01+ GATAACATCTTCCAACACCTCTCCTAGCCCGGTGTGTTGCTCGAAGCTCAAAGAGCAAAG
rJMSF028F13+ GATAACATCTTCCAACACCTCTCCTAGCCCGGTGTGTTGCTCGAAGCTCAAAGAGCAAAG
rJMSF029F13+ GATAACATCTTCCAACACCTCTCCTAGCCCGGTGTGTTGCTCGAAGCTCAAAGAGCAAAG
JMSF028F13- GATAACATCTTCCAACACCTCTCCTAGCCCGGTGTGTTGCTCGAAGCTCAAAGAGCAAAG
JMSF035E01- GATAACATCTTCCAACACCTCTCCTAGCCCGGTGTGTTGCTCGAAGCTCAAAGAGCAAAG
                      ____________________________________________________________
consensus GATAACATCTTCCAACACCTCTCCTAGCCCGGTGTGTTGCTCGAAGCTCAAAGAGCAAAG
 
. : . : . : . : . : . :
rJMSF035E01+ GCCTTGCCTATGCAAGTACATGAAGGATCCAAGGCTCCAAAGGTTCATTGCCTCTCCTAA
rJMSF028F13+ GCCTTGCCTATGCAAGTACATGAAGGATCCAAGGCTCCAAAGGTTCATTGCCTCTCCTAA
rJMSF029F13+ GCCTTGCCTATGCAAGTACATGAAGGATCCAAGGCTCCAAAGGTTCATTGCCTCTCCTAA
JMSF028F13- GCCTTGCCTATGCAAGTACATGAAGGATCCAAGGCTCCAAAGGTTCATTGCCTCTCCTAA
JMSF035E01- GCCTTGCCTATGCAAGTACATGAAGGATCCAAGGCTCCAAAGGTTCATTGCCTCTCCTAA
                      ____________________________________________________________
consensus GCCTTGCCTATGCAAGTACATGAAGGATCCAAGGCTCCAAAGGTTCATTGCCTCTCCTAA
 
. : . : . : . : . : . :
rJMSF035E01+ TGCCAAGAAGGTTGCCAACACTTGTGGGTCTCCCTTTCCTCGTTGCTAAAGGCAAACATC
rJMSF028F13+ TGCCAAGAAGGTTGCCAACACTTGTGGGTCTCCCTTTCCTCGTTGCTAAAGGCAAACATC
rJMSF029F13+ TGCCAAGAAGGTNGCCAACACTTGTGGGTCTCCCTTTCCTCGTTGCTAAAGGCAAACATC
JMSF028F13- TGCCAAGAAGGTTGCCAACACTTGTGGGTCTCCCTTTCCTCGTTGCTAAAGGCAAACATC
JMSF035E01- TGCCAAGAAGGTTGCCAACACTTGTGGGTCTCCCTTTCCTCGTTGCTAAAGGCAAACATC
                      ____________________________________________________________
consensus TGCCAAGAAGGTTGCCAACACTTGTGGGTCTCCCTTTCCTCGTTGCTAAAGGCAAACATC
 
. : . : . : . : . : . :
rJMSF035E01+ ACTTGACTTTGGTACTAAGTTGTCCCATCAAGTTGTATTAGTAATCCTTTCTATTACTAT
rJMSF028F13+ ACTTGACTTTGGTACTAAGTTGTCCCATCAAGTTGTATTAGTAATCCTTTCTATTACTAT
rJMSF029F13+ ACTTGACTTTGGTACTAAGTTGTCCCATCAAGTTGTATTAGTAATCCTTTCTATTACTAT
JMSF028F13- ACTTGACTTTGGTACTAAGTTGTCCCATCAAGTTGTATTAGTAATCCTTTCTATTACTAT
JMSF035E01- ACTTGACTTTGGTACTAAGTTGTCCCATCAAGTTGTATTAGTAATCCTTTCTATTACTAT
                      ____________________________________________________________
consensus ACTTGACTTTGGTACTAAGTTGTCCCATCAAGTTGTATTAGTAATCCTTTCTATTACTAT
 
. : . : . : . : . : . :
rJMSF035E01+ CTTATTTTGTCTCTTAATTATATATACAACTACTCCTACATATATATACTACCTATCATC
rJMSF028F13+ CTTATTTTGTCTCTTAATTATATATACAACTACTCCTACATATATATACTACCTATCATC
rJMSF029F13+ CNTATTTTGTCTCTTAATTATATATACAACTACTCCTACATATATATACTACCTATCATC
JMSF028F13- CTTATTTTGTCTCTTAATTATATATACAACTACTCCTACATATATATACTACCTATCATC
JMSF035E01- CTTATTTTGTCTCTTAATTATATATACAACTACTCCTACATATATATACTACCTATCATC
                      ____________________________________________________________
consensus CTTATTTTGTCTCTTAATTATATATACAACTACTCCTACATATATATACTACCTATCATC
 
. : . : . : . : . : . :
rJMSF035E01+ CAAGTTAAAAGTGGTGTATTTTGTTAACTAGTAAAAGAGAGTTGGTATCATATATGGGAC
rJMSF028F13+ CAAGTTAAAAGTGGTGTATTTTGTTAACTAGTAAAAGAGAGTTGGTATCATATATGGGAC
rJMSF029F13+ CAAGTTAAAAGTGGTGTATTTTGTTAACTAGTAAAAGAGAGTTGGTATCATATATGGGAC
JMSF028F13- CAAGTTAAAAGTGGTGTATTTTGTTAACTAGTAAAAGAGAGTTGGTATCATATATGGGAC
JMSF035E01- CAAGTTAAAAGTGGTGTATTTTGTTAACTAGTAAAAGAGAGTTGGTATCATATATGGGAC
                      ____________________________________________________________
consensus CAAGTTAAAAGTGGTGTATTTTGTTAACTAGTAAAAGAGAGTTGGTATCATATATGGGAC
 
. : . : . : . : . : . :
rJMSF035E01+ AATTGTTAGCTACTCTTAATATGTGTTCTATGTTGTTGTACTATGATGATATTAAATGGC
rJMSF028F13+ AATTGTTAGCTACTCTTAATATGTGTTCTATGTTGTTGTACTATGATGATA-TAAATGGC
rJMSF029F13+ AATTGTTAGCTACTCTTAATATGTGTTCTATGTTGTTGTACTATG
JMSF028F13- AATTGTTAGCTACTCTTAATATGTGTTCTATGTTGTTGTACTATGATGATATTAAATGGC
JMSF035E01- AATTGTTAGCTACTCTTAATATGTGTTCTATGTTGTTGTACTATGATGATATTAAATGGC
                      ____________________________________________________________
consensus AATTGTTAGCTACTCTTAATATGTGTTCTATGTTGTTGTACTATGATGATATTAAATGGC
 
. : . : . : . : . : . :
rJMSF035E01+ TTTTTTTGTAATGGAGACC
rJMSF028F13+ TTT
JMSF028F13- TTTTTTTGTAATGGAGACCTTGTATTATGGTTATACAA
JMSF035E01- TTTTTTTGTAATGGAGACCTTGTATTATGGTTATACAATGTTACGTGTTTGGTTGTATTG
                      ____________________________________________________________
consensus TTTTTTTGTAATGGAGACCTTGTATTATGGTTATACAATGTTACGTGTTTGGTTGTATTG