Previous Contig 007009:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF035D21Sequence697007009 (2)pir|T05606|T056063e-41protein kinase homolog F9D16.210 - Arabidopsis thaliana>gb:ATCHRIV60_1546257 Ara636013982 (2)gb:AP001800_18214172e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P044
JMSF052A23Sequence702007009 (2)pir|T05606|T056063e-41protein kinase homolog F9D16.210 - Arabidopsis thaliana>gb:ATCHRIV60_1546257 Ara864013982 (2)gb:AP001800_18214173e-77Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P044

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052A23+ TTCTTTCTGTGAATAGCAAAGAATCAACAGCACAGCAATTAC
JMSF035D21+ TCTGTGAATAGCAAAGAATCAACAGCACAGCAATTAC
                      ____________________________________________________________
consensus TTCTTTCTGTGAATAGCAAAGAATCAACAGCACAGCAATTAC
 
. : . : . : . : . : . :
JMSF052A23+ CGCAAACCCTAAAGCACAGCTTCCAATTATGATCCCCAGCAGTGCAGGTTCACTAAGGCT
JMSF035D21+ CGCAAACCCTAAAGCACAGCTTCCAATTATGATCCCCAGCAGTGCAGGTTCACTAAGGCT
                      ____________________________________________________________
consensus CGCAAACCCTAAAGCACAGCTTCCAATTATGATCCCCAGCAGTGCAGGTTCACTAAGGCT
 
. : . : . : . : . : . :
JMSF052A23+ TTTGGACTTCTTGCTCAGCGGAGCATCAGGAGGAAGAACAGAGGGAACGGGAGGTAAAGA
JMSF035D21+ TTTGGACTTCTTGCTCAGCGGAGCATCAGGAGGAAGAACAGAGGGAACGGGAGGTAAAGA
                      ____________________________________________________________
consensus TTTGGACTTCTTGCTCAGCGGAGCATCAGGAGGAAGAACAGAGGGAACGGGAGGTAAAGA
 
. : . : . : . : . : . :
JMSF052A23+ GATCACCGGAGAAAGATGGTTACCAGCAAAAGCTGAATCAGGGAATCTTCCAAGAGATGG
JMSF035D21+ GATCACCGGAGAAAGATGGTTACCAGCAAAAGCTGAATCAGGGAATCTTCCAAGAGATGG
                      ____________________________________________________________
consensus GATCACCGGAGAAAGATGGTTACCAGCAAAAGCTGAATCAGGGAATCTTCCAAGAGATGG
 
. : . : . : . : . : . :
JMSF052A23+ AGGCAAATTTCCAGTGAGGTTATTGTTGGACAGATCTAATAGCTGCAAGCTAGGGAGGTT
JMSF035D21+ AGGCAAATTTCCAGTGAGGTTATTGTTGGACAGATCTAATAGCTGCAAGCTAGGGAGGTT
                      ____________________________________________________________
consensus AGGCAAATTTCCAGTGAGGTTATTGTTGGACAGATCTAATAGCTGCAAGCTAGGGAGGTT
 
. : . : . : . : . : . :
JMSF052A23+ GAGATCAGGAATATCGCCCGAGAGCGAGTTGTTAGCAAGACTCAAAGCTGTCAAATGAGT
JMSF035D21+ GAGATCAGGAATATCGCCCGAGAGCGAGTTGTTAGCAAGACTCAAAGCTGTCAAATGAGT
                      ____________________________________________________________
consensus GAGATCAGGAATATCGCCCGAGAGCGAGTTGTTAGCAAGACTCAAAGCTGTCAAATGAGT
 
. : . : . : . : . : . :
JMSF052A23+ CAAGTTCGACATCGAGGAAGGTATGCTCCCATTAAACTCATTATTTGACAAATTCAACAC
JMSF035D21+ CAAGTTCGACATCGAGGAAGGTATGCTCCCATTAAACTCATTATTTGACAAATTCAACAC
                      ____________________________________________________________
consensus CAAGTTCGACATCGAGGAAGGTATGCTCCCATTAAACTCATTATTTGACAAATTCAACAC
 
. : . : . : . : . : . :
JMSF052A23+ TGAAAGGCTTTTCCAAACAGAAAAATCAGCCGGCAGAGGACCATGAAAGCTATTGGACTG
JMSF035D21+ TGAAAGGCTTTTCCAAACAGAAAAATCAGCCGGCAGAGGACCATGAAAGCTATTGGACTG
                      ____________________________________________________________
consensus TGAAAGGCTTTTCCAAACAGAAAAATCAGCCGGCAGAGGACCATGAAAGCTATTGGACTG
 
. : . : . : . : . : . :
JMSF052A23+ GAGATAGAGCATGGTCAAATTCTCAAGCTTCCAGAAATCAGAAGGGAAAGAACCAGAGAT
JMSF035D21+ GAGATAGAGCATGGTCAAATTCTCAAGCTTCCAGAAATCAGAAGGGAAAGAACCAGAGAT
                      ____________________________________________________________
consensus GAGATAGAGCATGGTCAAATTCTCAAGCTTCCAGAAATCAGAAGGGAAAGAACCAGAGAT
 
. : . : . : . : . : . :
JMSF052A23+ CCGATTGGATCTCAGACTCAAAATCTGAAGTCCAGATAAACGGCTCAAGGAATTCAAAGG
JMSF035D21+ CCGATTGGATCTCAGACTCAAAATCTGAAGTCCAGATAAACGGCTCAAGGAATTCAAAGG
                      ____________________________________________________________
consensus CCGATTGGATCTCAGACTCAAAATCTGAAGTCCAGATAAACGGCTCAAGGAATTCAAAGG
 
. : . : . : . : . : . :
JMSF052A23+ AATTGAGCCACGCATTCCAATTCCCGGCAACCTAACCGCTATGATTTTATCCTTATTATG
JMSF035D21+ AATTGAGCCACGCATTCCAATTCCCGGCAACCTAACCGCTATGATTTTATCCTTATTATG
                      ____________________________________________________________
consensus AATTGAGCCACGCATTCCAATTCCCGGCAACCTAACCGCTATGATTTTATCCTTATTATG
 
. : . : . : . : . : . :
JMSF052A23+ ATTGCAAGTCACTCCAACCCAGCTGCTACAAGCTGAGGTTTGCTCCTTCCAATTCAGCTT
JMSF035D21+ ATTGCAAGTCACTCCAACCCAGCTGCTACAAGCTGAGGTTTGCTCCTTCCAATTCAGCTT
                      ____________________________________________________________
consensus ATTGCAAGTCACTCCAACCCAGCTGCTACAAGCTGAGGTTTGCTCCTTCCAATTCAGCTT