Previous Contig 007008:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021P11Sequence490007008 (3)gb:AC079887_17329507e-10Oryza sativa (japonica cultivar-group) chromosome 3 BAC OSJNBa0040E01 genomic se570012968 (3)
JMFF040C23Sequence600007008 (3)gb:AC079887_17329501e-10Oryza sativa (japonica cultivar-group) chromosome 3 BAC OSJNBa0040E01 genomic se358012968 (3)
JMSF035D16Sequence676007008 (3)737012968 (3)pir|D86393|D863936e-09hypothetical protein T1K7.1 - Arabidopsis thaliana>gb:AE005172_891536 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF040C23+ TTGCTATCAGCAAGAGAATTG
                      ____________________________________________________________
consensus TTGCTATCAGCAAGAGAATTG
 
. : . : . : . : . : . :
JMFF040C23+ ATTCTGTGAGGATTGGCGTTTGAGGCCAAGATTGGAGCTTCCTCGAGCAATATGGGTTCA
                      ____________________________________________________________
consensus ATTCTGTGAGGATTGGCGTTTGAGGCCAAGATTGGAGCTTCCTCGAGCAATATGGGTTCA
 
. : . : . : . : . : . :
JMFF040C23+ TTCAAGTCAGCAAGACGATTGGTCCTCTTTGAGAACTCGAGATATCTGTCTTCATCACCA
JMFF021P11+ TGAGAACTCGAGATATCTGTCTTCATCACCA
                      ____________________________________________________________
consensus TTCAAGTCAGCAAGACGATTGGTCCTCTTTGAGAACTCGAGATATCTGTCTTCATCACCA
 
. : . : . : . : . : . :
JMFF040C23+ GCCCGTGGAATTTCTTTGTCTCGGGAGGAGAAATGACTAGCCCGGTTTTCGCCTTTTATG
JMFF021P11+ GCCCGTGGAATTTCTTTGTCTCGGGAGGAGAAATGACTAGCCCGGTTTTCGCCTTTTATG
                      ____________________________________________________________
consensus GCCCGTGGAATTTCTTTGTCTCGGGAGGAGAAATGACTAGCCCGGTTTTCGCCTTTTATG
 
. : . : . : . : . : . :
JMFF040C23+ AATTCAAACGGAGACCGACTGTAACTGGGAGGAGGAGCGTGAGACAACAAGTGCCCGAAA
JMFF021P11+ AATTCAAACGGAGACCGACTGTAACTGGGAGGAGGAGCGTGAGACAACAAGTGCCCGAAA
                      ____________________________________________________________
consensus AATTCAAACGGAGACCGACTGTAACTGGGAGGAGGAGCGTGAGACAACAAGTGCCCGAAA
 
. : . : . : . : . : . :
JMFF040C23+ CGAAAGGTCTCAGCTTTCATCGAATTCCTTTGCAGTTCTCTCGTTTTCAACTCACTCATA
JMFF021P11+ CGAAAGGTCTCAGCTTTCATCGAATTCCTTTGCAGTTCTCTCGTTTTCAACTCACTCATA
                      ____________________________________________________________
consensus CGAAAGGTCTCAGCTTTCATCGAATTCCTTTGCAGTTCTCTCGTTTTCAACTCACTCATA
 
. : . : . : . : . : . :
JMFF040C23+ AGTTCCATCTGCCTCCTGTGAAGGCGATGCAGTTCTTGAAGCTGGTGCCTGAATATCGAT
JMFF021P11+ AGTTCCATCTGCCTCCTGTGAAGGCGATGCAGTTCTTGAAGCTGGTGCCTGAATATCGAT
                      ____________________________________________________________
consensus AGTTCCATCTGCCTCCTGTGAAGGCGATGCAGTTCTTGAAGCTGGTGCCTGAATATCGAT
 
. : . : . : . : . : . :
JMFF040C23+ TCATGCTTCAAAATCGTCTGCCTCACTTTCTCCTTGTCGTATTCAAAGTATCCATCCACA
JMFF021P11+ TCATGCTTCAAAATCGTCTGCCTCACTTTCTCCTTGTCGTATTCAAAGTATCCATCCACA
                      ____________________________________________________________
consensus TCATGCTTCAAAATCGTCTGCCTCACTTTCTCCTTGTCGTATTCAAAGTATCCATCCACA
 
. : . : . : . : . : . :
JMFF040C23+ GGCACAGGCACGCATGATGCGAAAAAGTCGAAATGCTGAACACTTCTTAGCGTTTGTTCT
JMFF021P11+ GGCACAGGCACGCATGATGCGAAAAAGTCGAAATGCTGAACACTTCTTAGCGTTTGTTCT
                      ____________________________________________________________
consensus GGCACAGGCACGCATGATGCGAAAAAGTCGAAATGCTGAACACTTCTTAGCGTTTGTTCT
 
. : . : . : . : . : . :
JMFF040C23+ TCATGATTTAGTAAAGACACCCTATTATTAACGTGGCCATTCAGATCCTTTACAGAGTAA
JMFF021P11+ TCATGATTTAGTAAAGACACCCTATTATTAACGTGGCCATTCAGATCCTTTACAGAGTAA
JMSF035D16+ ATCCTTTACAGAGTAA
                      ____________________________________________________________
consensus TCATGATTTAGTAAAGACACCCTATTATTAACGTGGCCATTCAGATCCTTTACAGAGTAA
 
. : . : . : . : . : . :
JMFF040C23+ AACGCTGGCAAATACGTCTTACATTGTATCT
JMFF021P11+ AACGCTGGCAAATACGTCTTACATTGTATCT
JMSF035D16+ AACGCTGGCAAATACGTCTTACATTGTATCTTAGTTCCCATTCCTAGCCACCCAGTTCTT
                      ____________________________________________________________
consensus AACGCTGGCAAATACGTCTTACATTGTATCTTAGTTCCCATTCCTAGCCACCCAGTTCTT
 
. : . : . : . : . : . :
JMSF035D16+ CTGCAGTTGTGCTATACCCTCTCAAAAGTGCAATATTTTCTGAGCCCAACAACAACCTCA
                      ____________________________________________________________
consensus CTGCAGTTGTGCTATACCCTCTCAAAAGTGCAATATTTTCTGAGCCCAACAACAACCTCA
 
. : . : . : . : . : . :
JMSF035D16+ ACAAGAAAGACAAGACCTCCGAGACCCAAAACCAGAAAGCTGCAATCTTTGTACCTTGGC
                      ____________________________________________________________
consensus ACAAGAAAGACAAGACCTCCGAGACCCAAAACCAGAAAGCTGCAATCTTTGTACCTTGGC
 
. : . : . : . : . : . :
JMSF035D16+ GGCCATTGAAGAACACAACCTTAAAAAAGATGATCTGCACAAGAAAACAACCCAGAAACA
                      ____________________________________________________________
consensus GGCCATTGAAGAACACAACCTTAAAAAAGATGATCTGCACAAGAAAACAACCCAGAAACA
 
. : . : . : . : . : . :
JMSF035D16+ AATCCCCATCTGTTGGGCCACTCTCTGATCAACCAAAAGCAGGCACAGTAACAGAACCTA
                      ____________________________________________________________
consensus AATCCCCATCTGTTGGGCCACTCTCTGATCAACCAAAAGCAGGCACAGTAACAGAACCTA
 
. : . : . : . : . : . :
JMSF035D16+ GATAAACATTTCTCTCTTCTCTCTCTCTCTACACAAAATCAAGCCTTTGAGAAGAACAAT
                      ____________________________________________________________
consensus GATAAACATTTCTCTCTTCTCTCTCTCTCTACACAAAATCAAGCCTTTGAGAAGAACAAT
 
. : . : . : . : . : . :
JMSF035D16+ GACTTGAAAATTGTCAACATCTTCTTTTATCTTTTATGGGAGTATAGTACAACTTTCTCT
                      ____________________________________________________________
consensus GACTTGAAAATTGTCAACATCTTCTTTTATCTTTTATGGGAGTATAGTACAACTTTCTCT
 
. : . : . : . : . : . :
JMSF035D16+ TTCGCCCTATGGGGCATCTTGATTCGCTCTATTCTTCTCTCTCTCCCCCATTCTTTTCTT
                      ____________________________________________________________
consensus TTCGCCCTATGGGGCATCTTGATTCGCTCTATTCTTCTCTCTCTCCCCCATTCTTTTCTT
 
. : . : . : . : . : . :
JMSF035D16+ TCTCTCCTCTCCAAAATGGCAATCTGATAGAGTGATAGATATATATCACAACAACGCATC
                      ____________________________________________________________
consensus TCTCTCCTCTCCAAAATGGCAATCTGATAGAGTGATAGATATATATCACAACAACGCATC
 
. : . : . : . : . : . :
JMSF035D16+ TACCGAATAAAATAATGGGGAGAAAAAATCAAAGATTTTCTGTGCTTGCGAAGAAGTGAA
                      ____________________________________________________________
consensus TACCGAATAAAATAATGGGGAGAAAAAATCAAAGATTTTCTGTGCTTGCGAAGAAGTGAA
 
. : . : . : . : . : . :
JMSF035D16+ GGAAGGACATGGGTATTTGTAGCTCATTTTCTAGATTCTGTCTCTGCCTCCTCTTTTCCC
                      ____________________________________________________________
consensus GGAAGGACATGGGTATTTGTAGCTCATTTTCTAGATTCTGTCTCTGCCTCCTCTTTTCCC