Previous Contig 007007:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030B10Sequence599007007 (5)gb:AC006922_15347866e-40Arabidopsis thaliana chromosome 2 clone T1J8 map g6825, complete sequence.>gb:AY719007007 (5)gb:AE016959_10227954e-71Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AE01
JMFS156B07Sequence502007007 (5)gb:AE016959_10227953e-33Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AE01
JMSF035D15Sequence671007007 (5)gb:AC006922_15347861e-47Arabidopsis thaliana chromosome 2 clone T1J8 map g6825, complete sequence.>gb:AY729007007 (5)gb:AC006922_15347861e-75Arabidopsis thaliana chromosome 2 clone T1J8 map g6825, complete sequence.>gb:AY

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS156B07+ GATGGTTT
                      ____________________________________________________________
consensus GATGGTTT
 
. : . : . : . : . : . :
JMFS156B07+ CATGGTTGATTTGTTAAGTCTTAGGAAGGATCTTCAGTTGATTAGGGAGAAAAATGTAGC
rJMFF030B10- GTTGATTAGGGAG-AAAATGTAGC
                      ____________________________________________________________
consensus CATGGTTGATTTGTTAAGTCTTAGGAAGGATCTTCAGTTGATTAGGGAGAAAAATGTAGC
 
. : . : . : . : . : . :
JMFS156B07+ ACCCGGGACAATTTCCTACAGATTTGTTGAGTTCGCTACATCGCACTAGACTTTTCTTAC
rJMFF030B10- ACCCGGGACAATTTCCTACAGATTTGTTGAGTTCGCTACATCGCACTAGACTTTTCTTAC
rJMSF035D15- GATTTGTTGAGTTCGCTACATCGCACTAGACTTTTCTTAC
                      ____________________________________________________________
consensus ACCCGGGACAATTTCCTACAGATTTGTTGAGTTCGCTACATCGCACTAGACTTTTCTTAC
 
. : . : . : . : . : . :
JMFS156B07+ AATTGTACATAGTTTCCTTAAGTTTGTAAGATTTTTCAGATGTGCAAAAAAACAGTAATA
rJMFF030B10- AATTGTACATAGTTTCCTTAAGTTTGTAAGATTTTTCAGATGTGCAAAAAAACAGTAATA
rJMSF035D15- AATTGTACATAGTTTCCTTAAGTTTGTAAGATTTTTCAGATGTGCAAAAAAACAGTAATA
                      ____________________________________________________________
consensus AATTGTACATAGTTTCCTTAAGTTTGTAAGATTTTTCAGATGTGCAAAAAAACAGTAATA
 
. : . : . : . : . : . :
JMFS156B07+ CATCTGTAAGGAATCCAGAATTTCAAGAGAAATTGAGATTGCAAAGGTCACAAAATCATG
rJMFF030B10- CATCTGTAAGGAATCCAGAATTTCAAGAGAAATTGAGATTGCAAAGGTCACAAAATCATG
rJMSF035D15- CATCTGTAAGGAATCCAGAATTTCAAGAGAAATTGAGATTGCAAAGGTCACAAAATCATG
                      ____________________________________________________________
consensus CATCTGTAAGGAATCCAGAATTTCAAGAGAAATTGAGATTGCAAAGGTCACAAAATCATG
 
. : . : . : . : . : . :
JMFS156B07+ CTGCTTCTTCAGTTTCCTTTGAATTTGCATTGGTTGCCAAGCCTCGAATCTTTACATCAT
rJMFF030B10- CTGCTTCTTCAGTTTCCTTTGAATTTGCATTGGTTGCCAAGCCTCGAATCTTTACATCAT
rJMSF035D15- CTGCTTCTTCAGTTTCCTTTGAATTTGCATTGGTTGCCAAGCCTCGAATCTTTACATCAT
                      ____________________________________________________________
consensus CTGCTTCTTCAGTTTCCTTTGAATTTGCATTGGTTGCCAAGCCTCGAATCTTTACATCAT
 
. : . : . : . : . : . :
JMFS156B07+ AATAAACTTCTTCCACTTTTCTAAGGTCATATTTCATTCCATCAAACTTTTTACGCAAGA
rJMFF030B10- AATAAACTTCTTCCACTTTTCTAAGGTCATATTTCATTCCATCAAACTTTTTACGCAAGA
rJMSF035D15- AATAAACTTCTTCCACTTTTCTAAGGTCATATTTCATTCCATCAAACTTTTTACGCAAGA
                      ____________________________________________________________
consensus AATAAACTTCTTCCACTTTTCTAAGGTCATATTTCATTCCATCAAACTTTTTACGCAAGA
 
. : . : . : . : . : . :
JMFS156B07+ AATCATTTCGAAGATTAAGCATGCGGAATGCAGCATGAAGATCTGTCATGAATTTTAGAA
rJMFF030B10- AATCATTTCGAAGATTAAGCATGCGGAATGCAGCATGAAGATCTGTCATGAATTTTAGAA
rJMSF035D15- AATCATTTCGAAGATTAAGCATGCGGAATGCAGCATGAAGATCTGTCATGAATTTTAGAA
                      ____________________________________________________________
consensus AATCATTTCGAAGATTAAGCATGCGGAATGCAGCATGAAGATCTGTCATGAATTTTAGAA
 
. : . : . : . : . : . :
JMFS156B07+ CCTGGCGGGGGCAATCATAATCCCCAGCTGTCACTTTGTTCACCACATACCTAGGCAACT
rJMFF030B10- CCTGGCGGGGGCAATCATAATCCCCAGCTGTCACTTTGTTCACCACATACCTAGGCAACT
rJMSF035D15- CCTGGCGGGGGCAATCATAATCCCCAGCTGTCACTTTGTTCACCACATACCTAGGCAACT
JMSF035D15+ CCTAGGCAACT
                      ____________________________________________________________
consensus CCTGGCGGGGGCAATCATAATCCCCAGCTGTCACTTTGTTCACCACATACCTAGGCAACT
 
. : . : . : . : . : . :
JMFS156B07+ CATTAGACATGAAA
rJMFF030B10- CATTAGACATGAAACAAATCCCAATAAGGTAATCTTCAGTATCAAGTCCAAAATCTGAAG
rJMSF035D15- CATTAGACATGAAACAAATCCCAATAAGGTAATCTTCAGTATCAAGTCCAAAATCTGAAG
JMFF030B10+ TAATCTTCAGTATCAAGTCCAAAATCTGAAG
JMSF035D15+ CATTAGACATGAAACAAATCCCAATAAGGTAATCTTCAGTATCAAGTCCAAAATCTGAAG
                      ____________________________________________________________
consensus CATTAGACATGAAACAAATCCCAATAAGGTAATCTTCAGTATCAAGTCCAAAATCTGAAG
 
. : . : . : . : . : . :
rJMFF030B10- CATTTAAGCCCAATTTTTCCTCAACTTCATTATGCAGGAGAAGAGTCCCTGTCTCCAGCC
rJMSF035D15- CATTTAAGCCCAATTTTTCCTCAACTTCATTATGCAGGAGAAGAGTCCCTGTCTCCAGCC
JMFF030B10+ CATTTAAGCCCAATTTTTCCTCAACTTCATTATGCAGGAGAAGAGTCCCTGTCTCCAGCC
JMSF035D15+ CATTTAAGCCCAATTTTTCCTCAACTTCATTATGCAGGAGAAGAGTCCCTGTCTCCAGCC
                      ____________________________________________________________
consensus CATTTAAGCCCAATTTTTCCTCAACTTCATTATGCAGGAGAAGAGTCCCTGTCTCCAGCC
 
. : . : . : . : . : . :
rJMFF030B10- AATGCATAAATGCCAGCAATGACACCACAGTCTGTGTCTCACTCCTCCAAAGACCATTAT
rJMSF035D15- AATGCATAAATGCCAGCAATGACACCACAGTCTGTGTCTCACTCCTCCAAAGACCATTAT
JMFF030B10+ AATGCATAAATGCCAGCAATGACACCACAGTCTGTGTCTCACTCCTCCAAAGACCATTAT
JMSF035D15+ AATGCATAAATGCCAGCAATGACACCACAGTCTGTGTCTCACTCCTCCAAAGACCATTAT
                      ____________________________________________________________
consensus AATGCATAAATGCCAGCAATGACACCACAGTCTGTGTCTCACTCCTCCAAAGACCATTAT
 
. : . : . : . : . : . :
rJMFF030B10- ACCTATAATACTGTCCAGGGCATTCCCGCAGAATTTCTGAAATCTTGGTATACAGTTCCT
rJMSF035D15- ACCTATAATACTGTCCAGGGCATTCCCGCAGAATTTCTGAAATCTTGGTATACAGTTCCT
JMFF030B10+ ACCTATAATACTGTCCAGGGCATTCCCGCAGAATTTCTGAAATCTTGGTATACAGTTCCT
JMSF035D15+ ACCTATAATACTGTCCAGGGCATTCCCGCAGAATTTCTGAAATCTTGGTATACAGTTCCT
                      ____________________________________________________________
consensus ACCTATAATACTGTCCAGGGCATTCCCGCAGAATTTCTGAAATCTTGGTATACAGTTCCT
 
. : . : . : . : . : . :
rJMFF030B10- TCAGCACCCCGATATGAACACTTGCTTTCTCTAAGA
rJMSF035D15- TCAGCACCCCGATATGAACACTTGCTTTCTCTAAGACCTCGGGAACGGGGCGAGACTGAT
JMFF030B10+ TCAGCACCCCGATATGAACACTTGCTTTCTCTAAGACCTCGGGAACGGGGCGAGACTGAT
JMSF035D15+ TCAGCACCCCGATATGAACACTTGCTTTCTCTAAGACCTCGGGAACGGGGCGAGACTGAT
                      ____________________________________________________________
consensus TCAGCACCCCGATATGAACACTTGCTTTCTCTAAGACCTCGGGAACGGGGCGAGACTGAT
 
. : . : . : . : . : . :
rJMSF035D15- GAATGAGGAGGAGGCTAGAGTGAATGAGC
JMFF030B10+ GAATGAGGAGGAGGCTAGAGTGAATGAGCCGAGTAGTGGACTCCATCTCCATAGCCACAG
JMSF035D15+ GAATGAGGAGGAGGCTAGAGTGAATGAGCCGAGTAGTGGACTCCATCTCCATAGCCACAG
                      ____________________________________________________________
consensus GAATGAGGAGGAGGCTAGAGTGAATGAGCCGAGTAGTGGACTCCATCTCCATAGCCACAG
 
. : . : . : . : . : . :
JMFF030B10+ CTCTAATTCGATCGTGTAAGCTCGAAGAATCCAGCAAATTCTTCCGGAATTCCTCGAACT
JMSF035D15+ CTCTAATTCGATCGTGTAAGCTCGAAGAATCCAGCAAATTCTTCCGGAATTCCTCGAACT
                      ____________________________________________________________
consensus CTCTAATTCGATCGTGTAAGCTCGAAGAATCCAGCAAATTCTTCCGGAATTCCTCGAACT
 
. : . : . : . : . : . :
JMFF030B10+ GCTTCTCCAGCTTCTCTGAAGAATGGGAGAGAGGCGCGTCGAGATCACCGGCCGCCATTG
JMSF035D15+ GCTTCTCCAGCTTCTCTGAAGAATGGGAGAGAGGCGCGTCGAGATCACCGGCCGCCATTG
                      ____________________________________________________________
consensus GCTTCTCCAGCTTCTCTGAAGAATGGGAGAGAGGCGCGTCGAGATCACCGGCCGCCATTG
 
. : . : . : . : . : . :
JMFF030B10+ AAGTGCAGTATGAAACCGAAACGAGGACGTTGCAAAGAGGGACTGAGAAATTGCGAGCGG
JMSF035D15+ AAGTGCAGTATGAAACCGAAACGAGGACGTTGCAAAGAGGGACTGAGAAATTGCGAGCGG
                      ____________________________________________________________
consensus AAGTGCAGTATGAAACCGAAACGAGGACGTTGCAAAGAGGGACTGAGAAATTGCGAGCGG
 
. : . : . : . : . : . :
JMFF030B10+ GAATGAGAGTGGGAGGGAAGGTGGGTTTAGGGTTTAAGGCGGTGCGAGGGAGTAGAGAAA
JMSF035D15+ GAATGAGAGTGGGAGGGAAGGTGGGTTTAGGGTTTAAGGCGGTGCGAGGGAGTAGAGAAA
                      ____________________________________________________________
consensus GAATGAGAGTGGGAGGGAAGGTGGGTTTAGGGTTTAAGGCGGTGCGAGGGAGTAGAGAAA
 
. : . : . : . : . : . :
JMFF030B10+ TGGCGTTCCGGAACACCGATTTCATCTT
JMSF035D15+ TGGCGTTCCGGAACACCGATTTCATCTTGGTATGCCCGACTTTGTGGTACAATATTTGTC
                      ____________________________________________________________
consensus TGGCGTTCCGGAACACCGATTTCATCTTGGTATGCCCGACTTTGTGGTACAATATTTGTC