Previous Contig 007005:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS167H05Sequence613007005 (5)pir|C86294|C862944e-30T24D18.7 protein - Arabidopsis thaliana>gb:AE005172_890583 Arabidopsis thaliana
JMSF035D11Sequence662007005 (5)pir|C86294|C862947e-04T24D18.7 protein - Arabidopsis thaliana>gb:AE005172_890583 Arabidopsis thaliana 768007005 (5)gb:AP005453_18520673e-61Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P045
JMSF050N10Sequence661007005 (5)pir|C86294|C862946e-04T24D18.7 protein - Arabidopsis thaliana>gb:AE005172_890583 Arabidopsis thaliana 783007005 (5)gb:AP005453_18520674e-69Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P045

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF035D11- ATACATTCAGTTCATTTGTA
rJMSF050N10- ATACATTCAG-TCATTTGTA
                      ____________________________________________________________
consensus ATACATTCAGTTCATTTGTA
 
. : . : . : . : . : . :
rJMSF035D11- CACCAAAGCTTGTCGCCCTTCAACTGTAGATGATACAGAAGGGCGGGCGCCGGGCAGGAA
rJMSF050N10- CACCAAAGCTTGTCGCCCTTCAACTGTAGATGATACAGAAGGGCGGGCGCCGGGCAGGAA
                      ____________________________________________________________
consensus CACCAAAGCTTGTCGCCCTTCAACTGTAGATGATACAGAAGGGCGGGCGCCGGGCAGGAA
 
. : . : . : . : . : . :
rJMSF035D11- GCCAGCCCCTCCCTCGACAGGGTATTAATTACAAATTACAGTGCATCTACGACAACAAGC
rJMSF050N10- GCCAGCCCCTCCCTCGACAGGGTATTAATTACAAATTACAGTGCATCTACGACAACAAGC
                      ____________________________________________________________
consensus GCCAGCCCCTCCCTCGACAGGGTATTAATTACAAATTACAGTGCATCTACGACAACAAGC
 
. : . : . : . : . : . :
rJMSF035D11- TCAACTCATCCATAGCTTGTACTACTACTCCCACTCCCGTTCCCATTCCCATTCCTAATT
rJMSF050N10- TCAACTCATCCATAGCTTGTACTACTACTCCCACTCCCGTTCCCATTCCCATTCCTAATT
                      ____________________________________________________________
consensus TCAACTCATCCATAGCTTGTACTACTACTCCCACTCCCGTTCCCATTCCCATTCCTAATT
 
. : . : . : . : . : . :
rJMSF035D11- CAGTTTCATCTTCGGCTTGAATTACTTCGACCTTGGTTTTAAAGCTCTCGGCTTTGTCAC
rJMSF050N10- CAGTTTCATCTTCGGCTTGAATTACTTCGACCTTGGTTTTAAAGCTCTCGGCTTTGTCAC
                      ____________________________________________________________
consensus CAGTTTCATCTTCGGCTTGAATTACTTCGACCTTGGTTTTAAAGCTCTCGGCTTTGTCAC
 
. : . : . : . : . : . :
rJMSF035D11- TTGTGTCGCCTGCAGCTATGCAGTCCTGGAATCTGAAACAACTGATGAGATGGTCATTCG
rJMSF050N10- TTGTGTCGCCTGCAGCTATGCAGTCCTGGAATCTGAAACAACTGATGAGATGGTCATTCG
                      ____________________________________________________________
consensus TTGTGTCGCCTGCAGCTATGCAGTCCTGGAATCTGAAACAACTGATGAGATGGTCATTCG
 
. : . : . : . : . : . :
rJMSF035D11- AGATTCCAGCAGCTTGCATGAATGAGTATACAACGGTGGGTCCAATTCCTCGGAAACCTC
rJMSF050N10- AGATTCCAGCAGCTTGCATGAATGAGTATACAACGGTGGGTCCAATTCCTCGGAAACCTC
                      ____________________________________________________________
consensus AGATTCCAGCAGCTTGCATGAATGAGTATACAACGGTGGGTCCAATTCCTCGGAAACCTC
 
. : . : . : . : . : . :
rJMSF035D11- TTCTAACTAGATCTTTGCTTATCGTTTCAGCTTTTGATGTCTTGATTGGAACCTGTCTTG
rJMSF050N10- TTCTAACTAGATCTTTGCTTATCGTTTCAGCTTTTGATGTCTTGATTGGAACCTGTCTTG
                      ____________________________________________________________
consensus TTCTAACTAGATCTTTGCTTATCGTTTCAGCTTTTGATGTCTTGATTGGAACCTGTCTTG
 
. : . : . : . : . : . :
rJMSF035D11- GGTAACGGAAATTACCAACTATAGGCTTGTTGTTTACGAAACCCCATATGTACTTGTCAA
rJMSF050N10- GGTAACGGAAATTACCAACTATAGGCTTGTTGTTTACGAAACCCCATATGTACTTGTCAA
                      ____________________________________________________________
consensus GGTAACGGAAATTACCAACTATAGGCTTGTTGTTTACGAAACCCCATATGTACTTGTCAA
 
. : . : . : . : . : . :
rJMSF035D11- ACGACCCAATCTCATCAACTATCCTGCATATCTGGCGTGCATTTTCAATAATTGCTCGCA
rJMSF050N10- ACGACCCAATCTCATCAACTATCCTGCATATCTGGCGTGCATTTTCAATAATTGCTCGCA
                      ____________________________________________________________
consensus ACGACCCAATCTCATCAACTATCCTGCATATCTGGCGTGCATTTTCAATAATTGCTCGCA
 
. : . : . : . : . : . :
rJMSF035D11- GCTTCAACTCTGACAGGAGAGAGCTGGCAGGACTTCCTTGCATCAATACCTTCTTATCAT
rJMSF050N10- GCTTCAACTCTGACAGGAGAGAGCTGGCAGGACTTCCTTGCATCAATACCTTCTTATCAT
JMFS167H05+ CAT
                      ____________________________________________________________
consensus GCTTCAACTCTGACAGGAGAGAGCTGGCAGGACTTCCTTGCATCAATACCTTCTTATCAT
 
. : . : . : . : . : . :
rJMSF035D11- TCAGTTTTGAGACAGCAACAGGATCAAAATTTTGAAACACTTCTCGGAAGGTTTGCCTTC
rJMSF050N10- TCAGTTTTGAGACAGCAACAGGATCAAAATTTTGAAACACTTCTCGGAAGGTTTGCCTTC
JMFS167H05+ TCAGTTTTGAGACAGCAACAGGATCAAAATTNTGAAACACTTCTCGGAAGGTTTGCCTTC
                      ____________________________________________________________
consensus TCAGTTTTGAGACAGCAACAGGATCAAAATTTTGAAACACTTCTCGGAAGGTTTGCCTTC
 
. : . : . : . : . : . :
rJMSF035D11- TGCTGAGAATGGCTGGCCATGTAAGTTCAGCTAATGCAGTGCACAANCTAAGTAATTCGA
rJMSF050N10- TGCTGAGAATGGCTGGCCATGTAAGTTCAGCTAATGCAGTGCACAAACTAAGTAATTCGA
JMFS167H05+ TGCTGAGAATGGCTGGCCATGTAAGTTCAGCTAATGCAGTGCACAAACTAAGTAATTCGA
                      ____________________________________________________________
consensus TGCTGAGAATGGCTGGCCATGTAAGTTCAGCTAATGCAGTGCACAAACTAAGTAATTCGA
 
. : . : . : . : . : . :
rJMSF035D11- AAAGCTTTCTATCATCATGGACAGGA
rJMSF050N10- AAAGCTTTCTATCATCATGGACAGGAACTCCCC
JMFS167H05+ AAAGCTTTCTATCATCATGGACAGGAACTCCCCATTCCTCGTCATGGAAAGCAGCATATA
                      ____________________________________________________________
consensus AAAGCTTTCTATCATCATGGACAGGAACTCCCCATTCCTCGTCATGGAAAGCAGCATATA
 
. : . : . : . : . : . :
JMFS167H05+ ACGGATCAGTATTAGCAGTCACCCAAGCACACCTTTTCTTCAGCACAGAGACATCATCCG
                      ____________________________________________________________
consensus ACGGATCAGTATTAGCAGTCACCCAAGCACACCTTTTCTTCAGCACAGAGACATCATCCG
 
. : . : . : . : . : . :
JMFS167H05+ AACTCACAGACAAGCTTTCAACTTCACTTGCAAGTTTCTCGATGACCTTCTCCGTTTTGG
JMSF050N10+ G
JMSF035D11+ G
                      ____________________________________________________________
consensus AACTCACAGACAAGCTTTCAACTTCACTTGCAAGTTTCTCGATGACCTTCTCCGTTTTGG
 
. : . : . : . : . : . :
JMFS167H05+ GGCTGCATTGCTTCCTCCTAGCCGGTGTAGAGGTCATGCTCCGTCTGATAATTCTCCCCG
JMSF050N10+ GGCTGCATTGCTTCNTCCTAGCCGGTGTAGAGGTCATGCTCCGTCTGATAATTCTCCTCG
JMSF035D11+ GGCTGCATTGCTTCCTCCTAGCCGGTGTAGAGGTCATGCTCCGTCTGATAATTCTCCTCG
                      ____________________________________________________________
consensus GGCTGCATTGCTTCCTCCTAGCCGGTGTAGAGGTCATGCTCCGTCTGATAATTCTCCTCG
 
. : . : . : . : . : . :
JMFS167H05+ TGGACGCCCGGCTCTGAGAAGAGTCAGTCGACGCATCGGAGGAGCACGAGGCGTTGAGCG
JMSF050N10+ TGGACGCCCGGCTCTGAGAAGAGTCAGTCGACGCATCGGAGGAGCACGAGGCGTTGAGCG
JMSF035D11+ TGGACGCCCGGCTCTGAGAAGAGTCAGTCGACGCATCGGAGGAGCACGAGGCGTTGAGCG
                      ____________________________________________________________
consensus TGGACGCCCGGCTCTGAGAAGAGTCAGTCGACGCATCGGAGGAGCACGAGGCGTTGAGCG
 
. : . : . : . : . : . :
JMFS167H05+ ACAAGTTGGACCTCATCAAAAAGGACCTCTGGTCCTGCTGCTTCCGCAGAATTGAACCCA
JMSF050N10+ ACAAGTTGGACCTCATCAAAAAGGACCTCTGGTCCTGCTGCTTCCGCAGAATTGAACCCA
JMSF035D11+ ACAAGTTGGACCTCATCAAAAAGGACCTCTGGTCCTGCTGCTTCCGCAGAATTGAACCCA
                      ____________________________________________________________
consensus ACAAGTTGGACCTCATCAAAAAGGACCTCTGGTCCTGCTGCTTCCGCAGAATTGAACCCA
 
. : . : . : . : . : . :
JMFS167H05+ CACTGCCGCATTTCTTCAATGCCGATACCGGAGACCGCGATTTGGGCGGCTGATCAGCCA
JMSF050N10+ CACTGCCGCATTTCTTCAATGCCGATACCGGAGACCGCGATTTGGGCGGCTGATCAGCCA
JMSF035D11+ CACTGCCGCATTTCTTCAATGCCGATACCGGAGACCGCGATTTGGGCGGCTGATCAGCCA
                      ____________________________________________________________
consensus CACTGCCGCATTTCTTCAATGCCGATACCGGAGACCGCGATTTGGGCGGCTGATCAGCCA
 
. : . : . : . : . : . :
JMFS167H05+ CCGCCTCCGACATTGCCTGGAATCTCTTGCAGTCACTCTCTCGAGGCTTCTCCACCTTGT
JMSF050N10+ CCGCCTCCGACATTGCCTGGAATCTCTTGCAGTCACTCTCTCGAGGCTTCTCCACCTTGT
JMSF035D11+ CCGCCTCCGACATTGCCTGGAATCTCTTGCAGTCACTCTCTCGAGGCTTCTCCACCTTGT
                      ____________________________________________________________
consensus CCGCCTCCGACATTGCCTGGAATCTCTTGCAGTCACTCTCTCGAGGCTTCTCCACCTTGT
 
. : . : . : . : . : . :
JMFS167H05+ TACTCTTCAA
JMSF050N10+ TACTCTTCAACTTCTCAGCGGGTTTGCGCAGTTCGGCCGATCTCGCCTTATTTCCAGCCG
JMSF035D11+ TACTCTTCAACTTCTCAGCGGGTTTGCGCAGTTCGGCCGATCTCGCCTTATTTCCAGCCG
                      ____________________________________________________________
consensus TACTCTTCAACTTCTCAGCGGGTTTGCGCAGTTCGGCCGATCTCGCCTTATTTCCAGCCG
 
. : . : . : . : . : . :
JMSF050N10+ GTCCGAGTACGGGTCGGATCTCCGACTCGGCATTGTCCATCGATTTCACGCGGGGGACCG
JMSF035D11+ GTCCGAGTACGGGTCGGATCTCCGACTCGGCATTGTCCATCGATTTCACGCGGGGGACCG
                      ____________________________________________________________
consensus GTCCGAGTACGGGTCGGATCTCCGACTCGGCATTGTCCATCGATTTCACGCGGGGGACCG
 
. : . : . : . : . : . :
JMSF050N10+ GATATTGCGTGAATTGGACCCTCACAGTCGGATATTGGCGAAACTAGGGTTTTAGGGTGA
JMSF035D11+ GATATTGCGTGAATTGGACCCTCACAGTCGGATATTGGCGAAACTAGGGTTTTAGGGTGA
                      ____________________________________________________________
consensus GATATTGCGTGAATTGGACCCTCACAGTCGGATATTGGCGAAACTAGGGTTTTAGGGTGA
 
. : . : . : . : . : . :
JMSF050N10+ GAAGAGAGGTTGAAAAAGATGAAATGGTGGTGTATCCGGTTCCCAGGGTGGGAATGCAGA
JMSF035D11+ GAAGAGAGGTTGAAAAAGATGAAATGGTGGTGTATCCGGTTCCCAGGGTGGGAATGCAGA
                      ____________________________________________________________
consensus GAAGAGAGGTTGAAAAAGATGAAATGGTGGTGTATCCGGTTCCCAGGGTGGGAATGCAGA
 
. : . : . : . : . : . :
JMSF050N10+ GAAATGAAACCCTAGAGAGAGCAGAGTAGAAGGTACATTGATGACGATGAAGCCCCTGAG
JMSF035D11+ GAAATGAAACCCTAGAGAGAGCAGAGTAGAAGGTACATTGATGACGATGAAGCCCCTGAG
                      ____________________________________________________________
consensus GAAATGAAACCCTAGAGAGAGCAGAGTAGAAGGTACATTGATGACGATGAAGCCCCTGAG
 
. : . : . : . : . : . :
JMSF050N10+ GGTAGTAGAAGTAGAAGTAGAAGTAGGAGTGGGTCTGAGAAAATTGAAGCTGTTCGTTCC
JMSF035D11+ GGTAGTAGAAGTAGAAGTAGAAGTAGGAGTGGGTCTGAGAAAATTGAAGCTGTTCGTTCC
                      ____________________________________________________________
consensus GGTAGTAGAAGTAGAAGTAGAAGTAGGAGTGGGTCTGAGAAAATTGAAGCTGTTCGTTCC