Previous Contig 007000:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF035C20Sequence502007000 (2)gb:AF417481_17982801e-09Zea mays origin recognition complex subunit 1 (orc1) mRNA, complete cds.449007000 (2)gb:AP003508_18300683e-04Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF035C20+ GCTCGTTCCACCTCCCCTAATT
JMSF035C20- GCTCGTTCCACCTCCCCTAATT
                      ____________________________________________________________
consensus GCTCGTTCCACCTCCCCTAATT
 
. : . : . : . : . : . :
rJMSF035C20+ GTTTTCCTAAGCCGCAGACGCCCTGACCTAGTCTATCACCTCTTCCTTCAGATTGTCGCA
JMSF035C20- GTTTTCCTAAGCCGCAGACGCCCTGACCTAGTCTATCACCTCTTCCTTCAGATTGTCGCA
                      ____________________________________________________________
consensus GTTTTCCTAAGCCGCAGACGCCCTGACCTAGTCTATCACCTCTTCCTTCAGATTGTCGCA
 
. : . : . : . : . : . :
rJMSF035C20+ ACTCGCAAGTCGTCGTCGCCGCTTCCAGACCGCCATCGCCACCTCCAGACCGCCATCGCC
JMSF035C20- ACTCGCAAGTCGTCGTCGCCGCTTCCAGACCGCCATCGCCACCTCCAGACCGCCATCGCC
                      ____________________________________________________________
consensus ACTCGCAAGTCGTCGTCGCCGCTTCCAGACCGCCATCGCCACCTCCAGACCGCCATCGCC
 
. : . : . : . : . : . :
rJMSF035C20+ ACCTCCAGACATCCATCGCCAGTTGCCCAGTTCGCCACACAGCTTCGTTCGTTCGTCGCA
JMSF035C20- ACCTCCAGACATCCATCGCCAGTTGCCCAGTTCGCCACACAGCTTCGTTCGTTCGTCGCA
                      ____________________________________________________________
consensus ACCTCCAGACATCCATCGCCAGTTGCCCAGTTCGCCACACAGCTTCGTTCGTTCGTCGCA
 
. : . : . : . : . : . :
rJMSF035C20+ AGCAGCCATCGCCACCTCCGACGCCTTCCCCTTCGCAGCACGGCTGTTTTTTGTGTTGTC
JMSF035C20- AGCAGCCATCGCCACCTCCGACGCCTTCCCCTTCGCAGCACGGCTGTTTTTTGTGTTGTC
                      ____________________________________________________________
consensus AGCAGCCATCGCCACCTCCGACGCCTTCCCCTTCGCAGCACGGCTGTTTTTTGTGTTGTC
 
. : . : . : . : . : . :
rJMSF035C20+ ACTTGATAGTGGAGAAGGTGCACCAAATAAGTGCTTAGTACAGGATAGCAGAAAACTTAG
JMSF035C20- ACTTGATAGTGGAGAAGGTGCACCAAATAAGTGCTTAGTACAGGATAGCAGAAAACTTAG
                      ____________________________________________________________
consensus ACTTGATAGTGGAGAAGGTGCACCAAATAAGTGCTTAGTACAGGATAGCAGAAAACTTAG
 
. : . : . : . : . : . :
rJMSF035C20+ AGAAAATTGGGGAAAGATGTGCAATTGCCTGTCCCTCCTAAGGGAAAGAAAAGGGCTAAG
JMSF035C20- AGAAAATTGGGGAAAGATGTGCAATTGCCTGTCCCTCCTAAGGGAAAGAAAAGGGCTAAG
                      ____________________________________________________________
consensus AGAAAATTGGGGAAAGATGTGCAATTGCCTGTCCCTCCTAAGGGAAAGAAAAGGGCTAAG
 
. : . : . : . : . : . :
rJMSF035C20+ ACAGTAAGAGAGAAGCTGTTTGCCAGTGATCTGTATGCAGCTCACATTGAGAGTATATAG
JMSF035C20- ACAGTAAGAGAGAAGCTGTTTGCCAGTGATCTGTATGCAGCTCACATTGAGAGTATATAG
                      ____________________________________________________________
consensus ACAGTAAGAGAGAAGCTGTTTGCCAGTGATCTGTATGCAGCTCACATTGAGAGTATATAG
 
. : . : . : . : . : . :
rJMSF035C20+ AAAGT
JMSF035C20- AAAGTTGTAGACGGTACTTACCGGTTCAAGGCTCATTGGTATATTATTCCAAAAAAAAAA
                      ____________________________________________________________
consensus AAAGTTGTAGACGGTACTTACCGGTTCAAGGCTCATTGGTATATTATTCCAAAAAAAAAA