Previous Contig 006990:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN001A04Sequence591006990 (5)gb:AC113333_17389295e-15Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1115_B06, complete s
JMSF033P24Sequence632006990 (5)gb:AP005009_18472381e-34Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P057633006990 (5)gb:AC113333_17389292e-05Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1115_B06, complete s
JMSF034P24Sequence658006990 (5)gb:AP005009_18472382e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P057581006990 (5)gb:AC113333_17389296e-05Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1115_B06, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF034P24- ACATTTCTGCCAA-GTGCAGACCTTAAAAATCCTCTTAAA
rJMSF033P24- GATAACATTTCTGCCAAGGTGCAGACCTTAAAAATCCTCTTAAA
                      ____________________________________________________________
consensus GATAACATTTCTGCCAAGGTGCAGACCTTAAAAATCCTCTTAAA
 
. : . : . : . : . : . :
rJMSF034P24- GTTTACAGATTTACAGAATTACAGTGGCAACCTCAACTAAGTATAAATTCCAAACAAAAA
rJMSF033P24- GTTTACAGATTTACAGAATTACAGTGGCAACCTCAACTAAGTATAAATTCCAAACAAAAA
JMFN001A04+ AAAA
                      ____________________________________________________________
consensus GTTTACAGATTTACAGAATTACAGTGGCAACCTCAACTAAGTATAAATTCCAAACAAAAA
 
. : . : . : . : . : . :
rJMSF034P24- GTTGGAAAGAAAATACAGTGAGGATGTTGATTTTTACAGTTATGATTAGGGACAACACCT
rJMSF033P24- GTTGGAAAGAAAATACAGTGAGGATGTTGATTTTTACAGTTATGATTAGGGACAACACCT
JMFN001A04+ GTTGGAAAGAAAATACAGTGAGGATGTTGATTTTTACAGTTATGATTAGGGACAACACCT
                      ____________________________________________________________
consensus GTTGGAAAGAAAATACAGTGAGGATGTTGATTTTTACAGTTATGATTAGGGACAACACCT
 
. : . : . : . : . : . :
rJMSF034P24- CTTGTTGGGAGGATTCTGGGAATTATACATCAGTAATATATGACTTTGAGACGAGGCATG
rJMSF033P24- CTTGTTGGGAGGATTCTGGGAATTATACATCAGTAATATATGACTTTGAGACGAGGCATG
JMFN001A04+ CTTGTTGGGAGGATTCTGGGAATTATACATCAGTAATATATGACTTTGAGACGAGGCATG
                      ____________________________________________________________
consensus CTTGTTGGGAGGATTCTGGGAATTATACATCAGTAATATATGACTTTGAGACGAGGCATG
 
. : . : . : . : . : . :
rJMSF034P24- TGCCGGGTTGTTTAATACACCAAATTATTTTAACCCAGCGAGATCACCCCTTTTATCTGA
rJMSF033P24- TGCCGGGTTGTTTAATACACCAAATTATTTTAACCCAGCGAGATCACCCCTTTTATCTGA
JMFN001A04+ TGCCGGGTTGTTTAATACACCAAATTATTTTAACCCAGCGAGATCACCCCTTTTATCTGA
                      ____________________________________________________________
consensus TGCCGGGTTGTTTAATACACCAAATTATTTTAACCCAGCGAGATCACCCCTTTTATCTGA
 
. : . : . : . : . : . :
rJMSF034P24- ATCTATATTGTTCAGTCACTATTATTTGCAAAATTCAAACTTACTGGTATTTGTCAGCTA
rJMSF033P24- ATCTATATTGTTCAGTCACTATTATTTGCAAAATTCAAACTTACTGGTATTTGTCAGCTA
JMFN001A04+ ATCTATATTGTTCAGTCACTATTATTTGCAAAATTCAAACTTACTGGTATTTGTCAGCTA
                      ____________________________________________________________
consensus ATCTATATTGTTCAGTCACTATTATTTGCAAAATTCAAACTTACTGGTATTTGTCAGCTA
 
. : . : . : . : . : . :
rJMSF034P24- ACAAAGTCGAGGCAAGCATATCCTGGATAAAAAAAGCTCTTCCAGTGGCTTGCTCTATCC
rJMSF033P24- ACAAAGTCGAGGCAAGCATATCCTGGATAAAAAAAGCTCTTCCAGTGGCTTGCTCTATCC
JMFN001A04+ ACAAAGTCGAGGCAAGCATATCCTGGATAAAAAAAGCTCTTCCAGTGGCTTGCTCTATCC
                      ____________________________________________________________
consensus ACAAAGTCGAGGCAAGCATATCCTGGATAAAAAAAGCTCTTCCAGTGGCTTGCTCTATCC
 
. : . : . : . : . : . :
rJMSF034P24- TTTTTTCTCGCTCTTCATAACTTAGCGATGGATCCAAACTTAACTTCCATATGTGTTCAG
rJMSF033P24- TTTTTTCTCGCTCTTCATAACTTAGCGATGGATCCAAACTTAACTTCCATATGTGTTCAG
JMFN001A04+ TTTTTTCTCGCTCTTCATAACTTAGCGATGGATCCAAACTTAACTTCCATATGTGTTCAG
JMSF033P24+ GATCCAAACTTAACTTCCATATGTGTTCAG
JMSF034P24+ TTTTCTCGCTCTTCATAACTTAGCGATGGATCCAAACTTAACTTCCATATGTGTTCAG
                      ____________________________________________________________
consensus TTTTTTCTCGCTCTTCATAACTTAGCGATGGATCCAAACTTAACTTCCATATGTGTTCAG
 
. : . : . : . : . : . :
rJMSF034P24- ATCCCGCACTCTTTGTAGGACTGTCCTCAATACTGGATACCACAGATTTTGAAATTTCTT
rJMSF033P24- ATCCCGCACTCTTTGTAGGACTGTCCTCAATACTGGATACCACAGATTTTGAAATTTCTT
JMFN001A04+ ATCCCGCACTCTTTGTAGGACTGTCCTCAATACTGGATACCACAGATTTTGAAATTTCTT
JMSF033P24+ ATCCCGCACTCTTTGTAGGACTGTCCTCAATACTGGATACCACAGATTNTGAAATTTCTT
JMSF034P24+ ATCCCGCACTCTTTGTAGGACTGTCCTCAATACTGGATACCACAGATTTTGAAATTTCTT
                      ____________________________________________________________
consensus ATCCCGCACTCTTTGTAGGACTGTCCTCAATACTGGATACCACAGATTTTGAAATTTCTT
 
. : . : . : . : . : . :
rJMSF034P24- CGACTTCAGACCCGGGGAAGTTGAGCACAAGAGACGAGAGGAAGGGATCACTAGGGGCAC
rJMSF033P24- CGACTTCAGACCCGGGGAAGTTGAGCACAAGAGACGAGAGGAAGGGATCACTAGGGGCAC
JMFN001A04+ CGACTTCAGACCCGGGGAAGTTGAGCACAAGAGACGAGAGGAAGGGATCACTAGGGGCAC
JMSF033P24+ CGACTTCAGACCCGGGGAAGTTGAGCACAAGAGACGAGAGGAAGGGATCACTAGGGGCAC
JMSF034P24+ CGACTTCAGACCCGGGGAAGTTGAGCACAAGAGACGAGAGGAAGGGATCACTAGGGGCAC
                      ____________________________________________________________
consensus CGACTTCAGACCCGGGGAAGTTGAGCACAAGAGACGAGAGGAAGGGATCACTAGGGGCAC
 
. : . : . : . : . : . :
rJMSF034P24- TA
rJMSF033P24- TAGATGAAGTTGCGGTGTTTGATCGATACCCGCTGCCTCCTAAAAGCAC
JMFN001A04+ TAGATGAAGTTGCGGTGTTTGATCGATACCCGCTGCCTCCTAGAAGCACCTGTAGATGGG
JMSF033P24+ TAGATGAAGTTGCGGTGTTTGATCGATACCCGCTGCCTCCTAGAAGCACCTGTAGATGGG
JMSF034P24+ TAGATGAAGTTGCGGTGTTTGATCGATACCCGCTGCCTCCTAGAAGCACCTGTAGATGGG
                      ____________________________________________________________
consensus TAGATGAAGTTGCGGTGTTTGATCGATACCCGCTGCCTCCTAGAAGCACCTGTAGATGGG
 
. : . : . : . : . : . :
JMFN001A04+ CTTCCCGAAGATCCCTTCCTAATAAAGAAAGTGCCTGACTGCTGGGA
JMSF033P24+ CTTCCCGAAGATCCCTTCCTAATAAAGAAAGTGCCTGACTGCTGGGAATCGCAACCCTGC
JMSF034P24+ CTTCCCGAAGATCCCTTCCTAATAAAGAAAGTGCCTGACTGCTGGGAATCGCAACCCTGC
                      ____________________________________________________________
consensus CTTCCCGAAGATCCCTTCCTAATAAAGAAAGTGCCTGACTGCTGGGAATCGCAACCCTGC
 
. : . : . : . : . : . :
JMSF033P24+ GTAACCTCCGACGGCGCTGCAACTTGAGCAATTGTCCGTGCTGCAGTGTGATATGGCTTA
JMSF034P24+ GTAACCTCCGACGGCGCTGCAACTTGAGCAATTGTCCGTGCTGCAGTGTGATATGGCTTA
                      ____________________________________________________________
consensus GTAACCTCCGACGGCGCTGCAACTTGAGCAATTGTCCGTGCTGCAGTGTGATATGGCTTA
 
. : . : . : . : . : . :
JMSF033P24+ ACATGTCCCTCGAAACTTTAACAGAACAAATGGGACAAATGGTGACTTTGGACTCGCAAG
JMSF034P24+ ACATGTCCCTCGAAACTTTAACAGAACAAATGGGACAAATGGTGACTTTGGACTCGCAAG
                      ____________________________________________________________
consensus ACATGTCCCTCGAAACTTTAACAGAACAAATGGGACAAATGGTGACTTTGGACTCGCAAG
 
. : . : . : . : . : . :
JMSF033P24+ AATGCTCGTCTTCCAGATGGGAGCAAAGGGAGGTAATATCGAAGTCCTCATAACAATACG
JMSF034P24+ AATGCTCGTCTTCCAGATGGGAGCAAAGGGAGGTAATATCGAAGTCCTCATAACAATACG
                      ____________________________________________________________
consensus AATGCTCGTCTTCCAGATGGGAGCAAAGGGAGGTAATATCGAAGTCCTCATAACAATACG
 
. : . : . : . : . : . :
JMSF033P24+ GGCATGGGAAATCGGGTCGGGCCTNTTNTTCAACCTCGAAATCATCTA
JMSF034P24+ GGCATGGGAAATCGGGTCGGGCCTCTTCTTCAACCTCGAAATCATCTAAGCTCAGCCGAT
                      ____________________________________________________________
consensus GGCATGGGAAATCGGGTCGGGCCTCTTCTTCAACCTCGAAATCATCTAAGCTCAGCCGAT
 
. : . : . : . : . : . :
JMSF034P24+ CCAATTGAGAGGTGTTGTTATGGTAGTATGTGTGATGGTGATGCTGCAAATTGAATTGCC
                      ____________________________________________________________
consensus CCAATTGAGAGGTGTTGTTATGGTAGTATGTGTGATGGTGATGCTGCAAATTGAATTGCC
 
. : . : . : . : . : . :
JMSF034P24+ GCTTGGCAGCTGCGAGGCGAGAGGTCCAGAAATCAGTATCCATGAATGAGAGAAACGGTC
                      ____________________________________________________________
consensus GCTTGGCAGCTGCGAGGCGAGAGGTCCAGAAATCAGTATCCATGAATGAGAGAAACGGTC