Previous Contig 006988:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010N04Sequence546006988 (18)sp|Q9ZUB3|SPD1_ARATH1e-46Spermidine synthase 1 (EC 2.5.1.16) (Putrescine aminopropyltransferase 1) (SPDSY776006988 (18)sp|O82147|SPDE_COFAR1e-80Spermidine synthase (EC 2.5.1.16) (Putrescine aminopropyltransferase) (SPDSY).>g
JMFF029I21Sequence767006988 (18)sp|O82147|SPDE_COFAR8e-93Spermidine synthase (EC 2.5.1.16) (Putrescine aminopropyltransferase) (SPDSY).>g
JMFF031I08Sequence506006988 (18)sp|Q9ZUB3|SPD1_ARATH8e-49Spermidine synthase 1 (EC 2.5.1.16) (Putrescine aminopropyltransferase 1) (SPDSY697006988 (18)sp|O82147|SPDE_COFAR1e-64Spermidine synthase (EC 2.5.1.16) (Putrescine aminopropyltransferase) (SPDSY).>g
JMFF041L17Sequence656006988 (18)sp|Q9ZUB3|SPD1_ARATH2e-56Spermidine synthase 1 (EC 2.5.1.16) (Putrescine aminopropyltransferase 1) (SPDSY640006988 (18)sp|O82147|SPDE_COFAR2e-72Spermidine synthase (EC 2.5.1.16) (Putrescine aminopropyltransferase) (SPDSY).>g
JMFF044O16Sequence638006988 (18)sp|Q9ZUB3|SPD1_ARATH8e-73Spermidine synthase 1 (EC 2.5.1.16) (Putrescine aminopropyltransferase 1) (SPDSY645006988 (18)sp|O82147|SPDE_COFAR9e-53Spermidine synthase (EC 2.5.1.16) (Putrescine aminopropyltransferase) (SPDSY).>g
JMFF047I05Sequence516006988 (18)sp|Q9ZUB3|SPD1_ARATH4e-51Spermidine synthase 1 (EC 2.5.1.16) (Putrescine aminopropyltransferase 1) (SPDSY426006988 (18)sp|O82147|SPDE_COFAR3e-15Spermidine synthase (EC 2.5.1.16) (Putrescine aminopropyltransferase) (SPDSY).>g
JMFF049N01Sequence631006988 (18)sp|Q9ZUB3|SPD1_ARATH1e-61Spermidine synthase 1 (EC 2.5.1.16) (Putrescine aminopropyltransferase 1) (SPDSY
JMFN017I16Sequence624006988 (18)sp|Q9ZUB3|SPD1_ARATH2e-62Spermidine synthase 1 (EC 2.5.1.16) (Putrescine aminopropyltransferase 1) (SPDSY
JMFN031H09Sequence591006988 (18)sp|Q9ZUB3|SPD1_ARATH3e-41Spermidine synthase 1 (EC 2.5.1.16) (Putrescine aminopropyltransferase 1) (SPDSY
JMSF023J01Sequence546006988 (18)sp|Q9ZUB3|SPD1_ARATH2e-43Spermidine synthase 1 (EC 2.5.1.16) (Putrescine aminopropyltransferase 1) (SPDSY734006988 (18)sp|O82147|SPDE_COFAR4e-96Spermidine synthase (EC 2.5.1.16) (Putrescine aminopropyltransferase) (SPDSY).>g
JMSF034P08Sequence672006988 (18)sp|Q9ZUB3|SPD1_ARATH1e-27Spermidine synthase 1 (EC 2.5.1.16) (Putrescine aminopropyltransferase 1) (SPDSY731006988 (18)sp|O82147|SPDE_COFARe-106Spermidine synthase (EC 2.5.1.16) (Putrescine aminopropyltransferase) (SPDSY).>g

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF044O16- ACCCTGGAGAGTTTTTTTTTTTTTTTTCG
                      ____________________________________________________________
consensus ACCCTGGAGAGTTTTTTTTTTTTTTTTCG
 
. : . : . : . : . : . :
rJMFF044O16- GACACAGAATTGAGAAGAATTTTTATTGACGGTGGATATGTTGTATTGGTGTAATCAATC
rJMFF047I05- TTGACGGTGGATATGTTGTATTGGTGTAATCAATC
rJMFF031I08- ATTTTTATTGACGGTGGATATGTTGTATTGGTGTAATCAATC
rJMFF010N04- TTGACGGTGGATATGTTGTATTGGTGTAATCAATC
                      ____________________________________________________________
consensus GACACAGAATTGAGAAGAATTTTTATTGACGGTGGATATGTTGTATTGGTGTAATCAATC
 
. : . : . : . : . : . :
rJMFF044O16- AAATCAAATTGAGTGTATGCCCAAAATAAAACATCAATGTAATTGTTTTTTTATGGAGGA
rJMFF047I05- AAATCAAATTGAGTGTATGCCCAAAATAAAACATCAATGTAATTGTTTTTTTATGGAGGA
rJMFF031I08- AAATCAAATTGAGTGTATGCCCAAAATAAAACATCAATGTAATTGTTTTTTTATGGAGGA
rJMFF041L17- AAACATCAATGTAATTGTTTTTTTATGGAGGA
rJMFF010N04- AAATCAAATTGAGTGTATGCCCAAAATAAAACATCAATGTAATTGTTTTTTTATGGAGGA
rJMFF029I21- ATGTAATTGTTTTTTTATGGAGGA
                      ____________________________________________________________
consensus AAATCAAATTGAGTGTATGCCCAAAATAAAACATCAATGTAATTGTTTTTTTATGGAGGA
 
. : . : . : . : . : . :
rJMFF044O16- ATAAAACTACTTGTGAGTTTGACACTTGACTCATATTTCA-AGTCTTTAACCAATCCATG
rJMFF047I05- ATAAAACTACTTGTGAGTTTGACACTTGACTCATATTTCACAGTCTTTAACCAATCCATG
rJMFF031I08- ATAAAACTACTTGTGAGTTTGACACTTGACTCATATTTCA-AGTCTTTAACCAATCCATG
rJMFF041L17- ATAAAACTACTTGTGAGTTTGACACTTGACTCATATTTCA-AGTCTTTAACCAATCCATG
rJMFF010N04- ATAAAACTACTTGTGAGTTTGACACTTGACTCATATTTCA-AGTCTTTAACCAATCCATG
rJMSF023J01- ACTACTTGTGAGTTTGACACTTGACTCATATTTCA-AGTCTTTAACCAATCCATG
rJMFF029I21- ATAAAACTACTTGTGAGTTTGACACTTGACTCATATTTCA-AGTCTTTAACCAATCCATG
                      ____________________________________________________________
consensus ATAAAACTACTTGTGAGTTTGACACTTGACTCATATTTCA-AGTCTTTAACCAATCCATG
 
. : . : . : . : . : . :
rJMFF044O16- AAATGAATATGGATACAAACTCTTCTTGCAAGCTGCAACTCAAGAGTCTGCATACTTATA
rJMFF047I05- AAATGAATATGGATACAAACTCTTCTTGCAAGCTGCAACTCAAGAGTCTGCATACTTATA
rJMFF031I08- AAATGAATATGGATACAAACTCTTCTTGCAAGCTGCAACTCAAGAGTCTGCATACTTATA
rJMFF041L17- AAATGAATATGGATACAAACTCTTCTTGCAAGCTGCAACTCAAGAGTCTGCATACTTATA
rJMFF010N04- AAATGAATATGGATACAAACTCTTCTTGCAAGCTGCAACTCAAGAGTCTGCATACTTATA
rJMSF023J01- AAATGAATATGGATACAAACTCTTCTTGCAAGCTGCAACTCAAGAGTCTGCATACTTATA
rJMFF029I21- AAATGAATATGGATACAAACTCTTCTTGCAAGCTGCAACTCAAGAGTCTGCATACTTATA
rJMSF034P08- ATGAATATGGATACAAACTCTTCTTGCAAGCTGCAACTCAAGAGTCTGCATACTTATA
                      ____________________________________________________________
consensus AAATGAATATGGATACAAACTCTTCTTGCAAGCTGCAACTCAAGAGTCTGCATACTTATA
 
. : . : . : . : . : . :
rJMFF044O16- ACATCAACTCAAAACCCCTAAAAACACATTCCATTATCTCCCATTTCATTCCGCCTTTGA
rJMFF047I05- ACATCAACTCAAAACCCCTAAAAACACATTCCATTATCTCCCATTTCATTCCGCCTTTGA
rJMFF031I08- ACATCAACTCAAAACCCCTAAAAACACATTCCATTATCTCCCATTTCATTCCGCCTTTGA
rJMFF041L17- ACATCAACTCAAAACCCCTAAAAACACATTCCATTATCTCCCATTTCATTCCGCCTTTGA
rJMFF010N04- ACATCAACTCAAAACCCCTAAAAACACATTCCATTATCTCCCATTTCATTCCGCCTTTGA
rJMSF023J01- ACATCAACTCAAAACCCCTAAAAACACATTCCATTATCTCCCATTTCATTCCGCCTTTGA
rJMFF029I21- ACATCAACTCAAAACCCCTAAAAACACATTCCATTATCTCCCATTTCATTCCGCCTTTGA
rJMSF034P08- ACATCAACTCAAAACCCCTAAAAACACATTCCATTATCTCCCATTTCATTCCGCCTTTGA
                      ____________________________________________________________
consensus ACATCAACTCAAAACCCCTAAAAACACATTCCATTATCTCCCATTTCATTCCGCCTTTGA
 
. : . : . : . : . : . :
rJMFF044O16- TTCGATCACCTTCTTCGCGAATGATGGCAAGCAGAAAGCCGCAGAATGAATCTCGGAGTT
rJMFF047I05- TTCGATCACCTTCTTCGCGAATGATGGCAAGCAGAAAGCCGCAGAATGAATCTCGGAGTT
rJMFF031I08- TTCGATCACCTTCTTCGCGAATGATGGCAAGCAGAAAGCCGCAGAATGAATCTCGGAGTT
rJMFF041L17- TTCGATCACCTTCTTCGCGAATGATGGCAAGCAGAAAGCCGCAGAATGAATCTCGGAGTT
rJMFF010N04- TTCGATCACCTTCTTCGCGAATGATGGCAAGCAGAAAGCCGCAGAATGAATCTCGGAGTT
rJMSF023J01- TTCGATCACCTTCTTCGCGAATGATGGCAAGCAGAAAGCCGCAGAATGAATCTCGGAGTT
rJMFF029I21- TTCGATCACCTTCTTCGCGAATGATGGCAAGCAGAAAGCCGCAGAATGAATCTCGGAGTT
rJMSF034P08- TTCGATCACCTTCTTCGCGAATGATGGCAAGCAGAAAGCCGCAGAATGAATCTCGGAGTT
                      ____________________________________________________________
consensus TTCGATCACCTTCTTCGCGAATGATGGCAAGCAGAAAGCCGCAGAATGAATCTCGGAGTT
 
. : . : . : . : . : . :
rJMFF044O16- GTAGAACTTTAGGGGCGATTTTGATTTGGCATCATTAGCTTCATCTATTGGGTTGATCGG
rJMFF047I05- GTAGAACTTTAGGGGCGATTTTGATTTGGCATCATTAGCTTCATCTATTGNGTTGATCGG
rJMFF031I08- GTAGAACTTTAGGGGCGATTTTGATTTGGCATCATTAGCTTCATCTATTGGGTTGATCGG
rJMFF041L17- GTAGAACTTTAGGGGCGATTTTGATTTGGCATCATTAGCTTCATCTATTGGGTTGATCGG
rJMFF010N04- GTAGAACTTTAGGGGCGATTTTGATTTGGCATCATTAGCTTCATCTATTGGGTTGATCGG
rJMSF023J01- GTAGAACTTTAGGGGCGATTTTGATTTGGCATCATTAGCTTCATCTATTGGGTTGATCGG
rJMFF029I21- GTAGAACTTTAGGGGCGATTTTGATTTGGCATCATTAGCTTCATCTATTGGGTTGATCGG
rJMSF034P08- GTAGAACTTTAGGGGCGATTTTGATTTGGCATCATTAGCTTCATCTATTGGGTTGATCGG
                      ____________________________________________________________
consensus GTAGAACTTTAGGGGCGATTTTGATTTGGCATCATTAGCTTCATCTATTGGGTTGATCGG
 
. : . : . : . : . : . :
rJMFF044O16- ATGCTTGAAATCAACCGCTGGCCCCTCAGTAGAGCAAAGCATGAAACCGATAACCCCACT
rJMFF047I05- ATGCTTGAAAATCACCGCTGGCCC
rJMFF031I08- ATGCTTGAAATCAACCGCTGGCCCCTCAGTAGAGCAAAGCATGAAACCGATAACCCCACT
rJMFF041L17- ATGCTTGAAATCAACCGCTGGCCCCTCAGTAGAGCAAAGCATGAAACCGATAACCCCACT
rJMFF010N04- ATGCTTGAAATCAACCGCTGGCCCCTCAGTAGAGCAAAGCACGAAACCGATAACCCCACT
rJMSF023J01- ATGCTTGAAATCAACCGCTGGCCCCTCAGTAGAGCAAAGCATGAAACCGATAACCCCACT
rJMFF029I21- ATGCTTGAAATCAACCGCTGGCCCCTCAGTAGAGCAAAGCATGAAACCGATAACCCCACT
rJMSF034P08- ATGCTTGAAATCAACCGCTGGCCCCTCAGTAGAGCAAAGCATGAAACCGATAACCCCACT
                      ____________________________________________________________
consensus ATGCTTGAAATCAACCGCTGGCCCCTCAGTAGAGCAAAGCATGAAACCGATAACCCCACT
 
. : . : . : . : . : . :
rJMFF044O16- TGGGTATGTAGGAACCGTAGTCCATGCATAGTTGACAGAGCCTTTGAAAATTTGGCGACA
rJMFF031I08- TGGGTATGTAGGAACCGTAGTCCATGCATAGTTGACAGAGCCTTTGAAAATTTGGCGACA
rJMFF041L17- TGGGTATGTAGGAACCGTAGTCCATGCATAGTTGACAGAGCCTTTGAAAATTTGGCGACA
rJMFF010N04- TGGGTATGTAGGAACCGTAGTCCATGCATAGTTGACAGAGCCTTTGAAAATTTGGCGACA
rJMSF023J01- TGGGTATGTAGGAACCGTAGTCCATGCATAGTTGACAGAGCCTTTGAAAATTTGGCGACA
rJMFF029I21- TGGGTATGTAGGAACCGTAGTCCATGCATAGTTGACAGAGCCTTTGAAAATTTGGCGACA
rJMSF034P08- TGGGTATGTAGGAACCGTAGTCCATGCATAGTTGACAGAGCCTTTGAAAATTTGGCGACA
                      ____________________________________________________________
consensus TGGGTATGTAGGAACCGTAGTCCATGCATAGTTGACAGAGCCTTTGAAAATTTGGCGACA
 
. : . : . : . : . : . :
rJMFF044O16- GTTTGCCACGATATTTTCAATTATGTGCATGTGAAGCCATATGCTCTCGGCCTGTGTACA
rJMFF031I08- GTTTGCCACGATATTTTCAATTATGTGCATGTGAAGCCATATGCTCTCGGCCTGTGTACA
rJMFF041L17- GTTTGCCACGATATTTTCAATTATGTGCATGTGAAGCCATATGCTCTCGGCCTGTGTACA
rJMFF010N04- GTTTGCCACGATATTTTCAATTATGTGCATGTGAAGCCATATGCTCTCGGCCTGTGTACA
rJMSF023J01- GTTTGCCACGATATTTTCAATTATGTGCATGTGAAGCCATATGCTCTCGGCCTGTGTACA
rJMFF029I21- GTTTGCCACGATATTTTCAATTATGTGCATGTGAAGCCATATGCTCTCGGCCTGTGTACA
rJMSF034P08- GTTTGCCACGATATTTTCAATTATGTGCATGTGAAGCCATATGCTCTCGGCCTGTGTACA
                      ____________________________________________________________
consensus GTTTGCCACGATATTTTCAATTATGTGCATGTGAAGCCATATGCTCTCGGCCTGTGTACA
 
. : . : . : . : . : . :
rJMFF044O16- CACAACCCCCCCGGGGC
rJMFF031I08- CACAACCCCCCCGGGGCGAAGAGCCCTTGCCACCGTTTGAAAGAAAGGCTTTTCAAACAA
rJMFF041L17- CACAACCCCCCCGGGGCGAAGAGCCCTTGCCACCGTTTGAAAGAAAGGCTTTTCAAACAA
rJMFF010N04- CACAACCCCCCCGGGGCGAAGAGCCCTTGCCACCGTTTGAAAGAAAGGCTTTTCAAACAA
rJMSF023J01- CACAACCCCCCCGGGGCGAAGAGCCCTTGCCACCGTTTGAAAGAAAGGCTTTTCAAACAA
rJMFF029I21- CACAACCCCCCCGGGGCGAAGAGCCCTTGCCACCGTTTGAAAGAAAGGCTTTTCAAACAA
rJMSF034P08- CACAACCCCCCCGGGGCGAAGAGCCCTTGCCACCGTTTGAAAGAAAGGCTTTTCAAACAA
                      ____________________________________________________________
consensus CACAACCCCCCCGGGGCGAAGAGCCCTTGCCACCGTTTGAAAGAAAGGCTTTTCAAACAA
 
. : . : . : . : . : . :
rJMFF031I08- CTCTTGTGCAGGACCTATGGGGGTCGGATGAATCCACAATAACAGCATCATAGG
rJMFF041L17- CTCTTGTGCAGGACCTAT-GGGGTCGGATGAATCCACAATAACAGCATCATAGGTTCCTT
rJMFF010N04- CTCTTGTGCAGGACCTAT-GGGGTCGGATGAATCCACAATAACAGCATCATAGGTTCCTT
rJMSF023J01- CTCTTGTGCAGGACCTAT-GGGGTCGGATGAATCCACAATAACAGCATCATAGGTTCCTT
rJMFF029I21- CTCTTGTGCAGGACCTAT-GGGGTCGGATGAATCCACAATAACAGCATCATAGGTTCCTT
rJMSF034P08- CTCTTGTGCAGGACCTAT-GGGGTCGGATGAATCCACAATAACAGCATCATAGGTTCCTT
                      ____________________________________________________________
consensus CTCTTGTGCAGGACCTAT-GGGGTCGGATGAATCCACAATAACAGCATCATAGGTTCCTT
 
. : . : . : . : . : . :
rJMFF041L17- CAGCAACATT
rJMFF010N04- CAGCAACATTTTTCANGAACGCAACCCCATCGCCTATGTGGAGAGTTACACGGGGGATCC
rJMSF023J01- CAGCAACATTTTTCAGGAACGCAACCCCATCGCCTATGTGGAGAGTTACAC-GGGGATCC
rJMFF029I21- CAGCAACATTTTTCAGGAACGCAACCCCATCGCCTATGTGGAGAGTTACAC-GGGGATCC
rJMSF034P08- CAGCAACATTTTTCAGGAACGCAACCCCATCGCCTATGTGGAGAGTTACAC-GGGGATCC
JMFF044O16+ AGGAACGCAACCCCATCGCCTATGTGGAGAG-TACACNGGGGATCC
                      ____________________________________________________________
consensus CAGCAACATTTTTCAGGAACGCAACCCCATCGCCTATGTGGAGAGTTACACGGGGGATCC
 
. : . : . : . : . : . :
rJMFF010N04- TCATACCCAACAGCTACATCAGG
rJMSF023J01- TCATACCCAACAGCTACATCA-GGGAAAAATTGTTTGGCANCATCGACCACCATCTTATC
rJMFF029I21- TCATACCCAACAGCTACATCAGGGGAAAAATTGTTTGGCAACATCGACCACCATCTTATC
rJMSF034P08- TCATACCCAACAGCTACATCA-GGGAAAAATTGTTTGGCAACATCGACCACCATCTTATC
JMFF044O16+ TCATACCCAACAGCTACATCA-GGGAAAAATTGTTTGGCAACATCGACCACCATCTTATC
JMFN017I16+ GAAAAATTGTTTGGCAACATCGACCACCATCTTATC
JMFF049N01+ AAATTGTTTGGCAACATCGACCACCATCTTATC
JMFF041L17+ TATC
                      ____________________________________________________________
consensus TCATACCCAACAGCTACATCA-GGGAAAAATTGTTTGGCAACATCGACCACCATCTTATC
 
. : . : . : . : . : . :
rJMSF023J01- AATCTCACAGATGTCTATCTGAT
rJMFF029I21- AATCTCACAGATGTCTATCTGATCA
rJMSF034P08- AATCTCACAGATGTCTATCTGATCAACAGAAGCATGGCGAGCCACTTCACGCAAGACACC
JMFF044O16+ AATCTCACAGATGTCTATCTGATCAACAGAAGCATGGCGAGCCACTTCACGCAAGACACC
JMFN017I16+ AATCTCACAGATGTCTATCTGATCAACAGAAGCATGGCGAGCCACTTCACGCAAGACACC
JMFF049N01+ AATCTCACAGATGTCTATCTGATCAACAGAAGCATGGCGAGCCACTTCACGCAAGACACC
JMFF047I05+ GATCAACAGAAGCATGGCGAGCCACTTCACGCAAGACACC
JMFF031I08+ GAAGCATGGCGAGCCACTTCACGCAAGACACC
JMFF041L17+ AATCTCACAGATGTCTATCTGATCAACAGAAGCATGGCGAGCCACTTCACGCAAGACACC
                      ____________________________________________________________
consensus AATCTCACAGATGTCTATCTGATCAACAGAAGCATGGCGAGCCACTTCACGCAAGACACC
 
. : . : . : . : . : . :
rJMSF034P08- ACCAT-CCCCTCCTCCA
JMFF044O16+ ACCAT-CCCCTCCTCCAATAACCAATACCTTCTTGGGATTCGGAATTGAACAAAGCGGGA
JMFN017I16+ ACCAT-CCCCTCCTCCAATAACCAATACCTTCTTGGGATTCGGAATTGAACAAAGCGGGA
JMFF049N01+ ACCAT-CCCCTCCTCCAATAACCAATACCTTCTTGGGATTCGGAATTGAACAAAGCGGGA
JMFF010N04+ CCAATAACCAATACCTTCTTGGGATTCGGAATTGAACAAAGCGGGA
JMSF023J01+ TCCTCCAATAACCAATACCTTCTTGGGATTCGGAATTGAACAAAGCGGGA
JMFF047I05+ ACCAT-CCCCTCCTCCAATAACCAATACCTTCTGNGGATTCGGAATGNAACAAAGCGGGA
JMFF031I08+ ACCATCCCCCTCCTCCAATAACCAATACCTTCTTGGGATTCGGAATTGAACAAAGCGGGA
JMFF041L17+ ACCAT-CCCCTCCTCCAATAACCAATACCTTCTTGGGATTCGGAATTGAACAAAGCGGGA
JMFN031H09+ GAATTGAACAAAGCGGGA
                      ____________________________________________________________
consensus ACCAT-CCCCTCCTCCAATAACCAATACCTTCTTGGGATTCGGAATTGAACAAAGCGGGA
 
. : . : . : . : . : . :
JMFF044O16+ GATGAGTGATCATTTCTTGGTAAGCACATTCGTCTCTCTCTGTGATTTGAATCACACCGT
JMFN017I16+ GATGAGTGATCATTTCTTGGTAAGCACATTCGTCTCTCTCTGTGATTTGAATCACACCGT
JMFF049N01+ GATGAGTGATCATTTCTTGGTAAGCACATTCGTCTCTCTCTGTGATTTGAATCACACCGT
JMFF010N04+ GATGAGTGATCATTTCTTGGTAAGCACATTCGTCTCTCTCTGTGATTTGAATCACACCGT
JMSF023J01+ GATGAGTGATCATTTCTTGGTAAGCACATTCGTCTCTCTCTGTGATTTGAATCACACCGT
JMFF047I05+ GATGAGTGATCATTTCTTGGTAAGCACATTCGTCTCTCTCTGTGATTTGAATCACACCGT
JMFF031I08+ GATGAGTGATCATTTCTTGGTAAGCACATTCGTCTCTCTCTGTGATTTGAATCACACCGT
JMFF041L17+ GATGAGTGATCATTTCTTGGTAAGCACATTCGTCTCTCTCTGTGATTTGAATCACACCGT
JMFN031H09+ GATGAGTGATCATTTCTTGGTAAGCACATTCGTCTCTCTCTGTGATTTGAATCACACCGT
JMSF034P08+ GAATCACACCGT
                      ____________________________________________________________
consensus GATGAGTGATCATTTCTTGGTAAGCACATTCGTCTCTCTCTGTGATTTGAATCACACCGT
 
. : . : . : . : . : . :
JMFF044O16+ CCAAAACAAGCACCTTACCATAAGTAGAAGACTGAAACACCATGACATCCTGGTAATCTG
JMFN017I16+ CCAAAACAAGCACCTTACCATAAGTAGAAGACTGAAACACCATGACATCCTGGTAATCTG
JMFF049N01+ CCAAAACAAGCACCTTACCATAAGTAGAAGACTGAAACACCATGACATCCTGGTAATCTG
JMFF010N04+ CCAAAACAAGCACCTTACCATAAGTAGAAGACTGAAACACCATGACATCCTGGTAATCTG
JMSF023J01+ CCAAAACAAGCACCTTACCATAAGTAGAAGACTGAAACA-CATGACATCCTGGTAATCTG
JMFF047I05+ CCAAAACAAGCACCTTACCATAAGTAGAAGACTGAAACACCATGACATCCTGGTAATCTG
JMFF031I08+ CCAAAACAAGCACCTTACCATAAGTAGAAGACTGAAACACCATGACATCCTGGTAATCTG
JMFF041L17+ CCAAAACAAGCACCTTACCATAAGTAGAAGACTGAAACACCATGACATCCTGGTAATCTG
JMFN031H09+ CCAAAACAAGCACCTTACCATAAGTAGAAGACTGAAACACCATGACATCCTGGTAATCTG
JMSF034P08+ CCAAAACAAGCACCTTACCATAAGTAGAAGACTGAAACACCATGACATCCTGGTAATCTG
                      ____________________________________________________________
consensus CCAAAACAAGCACCTTACCATAAGTAGAAGACTGAAACACCATGACATCCTGGTAATCTG
 
. : . : . : . : . : . :
JMFF044O16+ ACTTCCCCTTAAACAATAGCTTTTCCACCTTCAATGAGTGTGCCTCTCCGGGCCACATTG
JMFN017I16+ ACTTCCCCTTAAACAATAGCTTTTCCACCTTCAATGAGTGTGCCTCTCCGGGCCACATTG
JMFF049N01+ ACTTCCCCTTAAACAATAGCTTTTCCACCTTCAATGAGTGTGCCTCTCCGGGCCACATTG
JMFF010N04+ ACTTCCCCTTAAACAATAGCTTTTCCACCTTCAATGAGTGTGCCTCTCCGGGCCACATTG
JMSF023J01+ ACTTCCCCTTAAACAATAGCTTTTCCACCTTCAATGAGTGTGCCTCTCCGGGCCACATTG
JMFF047I05+ ACTTCCCCTTAAACAATAGCTTTTCCACCTTCAATGAGTGTGCCTCTCCGGGCCACATTG
JMFF031I08+ ACTTCCCCTTAAACAATAGCTTTTCCACCTTCAATGAGTGTGCCTCTCCGGGCCACATTG
JMFF041L17+ ACTTCCCCTTAAACAATAGCTTTTCCACCTTCAATGAGTGTGCCTCTCCGGGCCACATTG
JMFN031H09+ ACTTCCCCTTAAACAATAACTTTTCCACCTTCAATGAGTGTGCCTCTCCGGGCCACATTG
JMSF034P08+ ACTTCCCCTTAAACAATAGCTTTTCCACCTTCAATGAGTGTGCCTCTCCGGGCCACATTG
                      ____________________________________________________________
consensus ACTTCCCCTTAAACAATAGCTTTTCCACCTTCAATGAGTGTGCCTCTCCGGGCCACATTG
 
. : . : . : . : . : . :
JMFF044O16+ GGCTAATCTCAGAGAACCAGCCAGGGATAACAGAGGAGAAACACTGCTCCCCTTTATCAC
JMFN017I16+ GGCTAATCTCAGAGAACCAGCCAGGGATAACAGAGGAGAAACACTGCTCCCCTTTATCAC
JMFF049N01+ GGCTAATCTCAGAGAACCAGCCAGGGATAACAGAGGAGAAACACTGCTCCCCTTTATCAC
JMFF010N04+ GGCTAATCTCAGAGAACCAGCCAGGGATAACAGAGGAGAAACACTGCTCCCCTTTATCAC
JMSF023J01+ GGCTAATCTCAGAGAACCAGCCAGGGATAACAGAGGAGAAACACTGCTCCCCTTTATCAC
JMFF047I05+ GGCTAATCTCAGAGAACCAGCCAGGGATAACAGAGGAGAAACACTGCTCCCCTTTATCAC
JMFF031I08+ GGCTAATCTCAGAGAACCAGCCAGGGATAACAGAGGAGAAACACTGCTCCCCTTTATCAC
JMFF041L17+ GGCTAATCTCAGAGAACCAGCCAGGGATAACAGAGGAGAAACACTGCTCCCCTTTATCAC
JMFN031H09+ GGCTAATCTCAGAGAACCAGCCAGGGATAACAGAGGAGAAACACTGCTCCCCTTTATCAC
JMSF034P08+ GGCTAATCTCAGAGAACCAGCCAGGGATAACAGAGGAGAAACACTGCTCCCCTTTATCAC
                      ____________________________________________________________
consensus GGCTAATCTCAGAGAACCAGCCAGGGATAACAGAGGAGAAACACTGCTCCCCTTTATCAC
 
. : . : . : . : . : . :
JMFF044O16+ CGGCGGCGTTGGCGTTGGTGTTGTTGTTGGCATCCTCCATTTCAACCGACACAGATTCAC
JMFN017I16+ CGGCGGCGTTGGCGTTGGTGTTGTTGTTGGCATCCTCCATTTCAACCGACACAGATTCAC
JMFF049N01+ CGGCGGCGTTGGCGTTGGTGTTGTTGTTGGCATCCTCCATTTCAACCGACACAGATTCAC
JMFF010N04+ CGGCGGCGTTGGCGTTGGTGTTGTTGTTGGCATCCTCCATTTCAACCGACACAGATTCAC
JMSF023J01+ CGGCGGCGTTGGCGTTGGTGTTGTTGTTGGCATCCTCCATTTCAACCGACAAAGATTCAC
JMFF047I05+ CGGCGGCGTTGGCGTTGGTGTTGTTGTTGGCATCCTCCATTTCAACCGACACAGATTCAC
JMFF031I08+ CGGCGGCGTTGGCGTTGGTGTTGTTGTTGGCATCCTCCATTTCAACCGACACAGATTCAC
JMFF041L17+ CGGCGGCGTTGGCGTTGGTGTTGTTGTTGGCATCCTCCATTTCAACCGACACAGATTCAC
JMFN031H09+ CGGCGGCGTTGGCGTTGGTGTTGTTGTTGGCATCCTCCATTTCAACCGACACAGATTCAC
JMSF034P08+ CGGCGGCGTTGGCGTTGGTGTTGTTGTTGGCATCCTCCATTTCAATCGACACAGATTCAC
                      ____________________________________________________________
consensus CGGCGGCGTTGGCGTTGGTGTTGTTGTTGGCATCCTCCATTTCAACCGACACAGATTCAC
 
. : . : . : . : . : . :
JMFF044O16+ CGTTCTGTCCGTCCTCTCTCTGCCTCTTAACCGGCAACTCACCGCCGCAGCCGCGTCACC
JMFN017I16+ CGTTCTGTCCGTCCTCTCTCTGCCTCTTAACCGGCAACTCACCGCCGCAGCCGCGTCACC
JMFF049N01+ CGTTCTGTCCGTCCTCTCTCTGCCTCTTAACCGGCAACTCACCGCCGCAGCCGCGTCACC
JMFF010N04+ CGTTCTGTCCGTCCTCTCTCTGCCTCTTAACCGGCAACTCACCGCCGCAGCCGCGTCACC
JMSF023J01+ CGTTCTGTCCGTCCTCTCTCTGCCTCTTAACCGGCAACTCACCGCCGCAGCCGCGTCACC
JMFF047I05+ CGTTCTGTCCGTCCTCTCTCTGCCTCTTAACCGGCAACTCACCGCCGCAGCCGCGTCACC
JMFF031I08+ CGTTCTGTCCGTCCTCTCTCTGCCTCTTAACCGGCAACTCACCGCCGCAGCCGCGTCACC
JMFF041L17+ CGTTCTGTCCGTCCTCTCTCTGCCTCTTAACCGGCAACTCACCGCCGCAGCCGCGTCACC
JMFN031H09+ CGTTCTGTCCGTCCTCTCTCTGCCTCTTAACCGGCAACTCACCGCCGCAGCCGCGTCACC
JMSF034P08+ CGTTCTGTCCGTCCTCTCTCTGCCTCTTAACCGGCAACTCACCGCCGCAGCCGCGTCACC
                      ____________________________________________________________
consensus CGTTCTGTCCGTCCTCTCTCTGCCTCTTAACCGGCAACTCACCGCCGCAGCCGCGTCACC
 
. : . : . : . : . : . :
JMFF044O16+ CTCTCCACACGTCTATAAATATATATGTGTGTGTGTATAGGTCGCAGAACCC
JMFN017I16+ CTCTCCACACGTCTATAAATATATATGTGTGTGTGTATAGGTCGCAGAACCCTGAATCTC
JMFF049N01+ CTCTCCACACGTCTATAAATATATATGTGTGTGTGTATAGGTCGCAGAACCCTGAATCTC
JMFF010N04+ CTCTCCACACGTCTATAAATATATATGTGTGTGTGTATAGGTCGCAGAACCCTGAATCTC
JMSF023J01+ CTCTCCACACGTCTATAAATATATATGTGTGTGTGTATAGGTCGCAGAACCCTGAATCTC
JMFF047I05+ CTCTCCACACGTCTATAAATATATATGTGTGTGTGTATAGGTCGCAGAACCCT
JMFF031I08+ CTCTCCACACGTCTATAAATATATATGTGTGTGTGTATAGGTCGCAGAACCC
JMFF041L17+ CTCTCCACACGTCTATAAATATATATGTGTGTGTGTATAGGTCGCAGAACCCTGAATCTC
JMFN031H09+ CTCTCCACACGTCTATAAATATATATGTGTGTGTGTATAGGTCGCAGAACCCTGAATCTC
JMSF034P08+ CTCTCCACACGTCTATAAATATATATGTGTGTGTGTATAGGTCGCAGAACCCTGAATCTC
                      ____________________________________________________________
consensus CTCTCCACACGTCTATAAATATATATGTGTGTGTGTATAGGTCGCAGAACCCTGAATCTC
 
. : . : . : . : . : . :
JMFN017I16+ TCCTCTTGAAAACAGAGGTATAAAGGGAAACAGACTGAAGGAATCAGCT
JMFF049N01+ TCCTCTTGAAAACAGAGGTATAAAGGGAAACAGACTGAAGGAATCAGCTTAGGAGAAAC
JMFF010N04+ TCCTCTTGAAAACAGAGGTATAAAGGGAAACAGACTGAAGGAATCAGCTTAGGAGAAACG
JMSF023J01+ TCCTCTTGAAAACAGAGGTATAAAGGGAAACAGACTGAAGGAATCAGCTTAGGAGAAACG
JMFF041L17+ TCCTCTTGAAAACAGAGGTATAAAGGGAAACAGACTGAAGGAATCAGCTTAGGAGAAACG
JMFN031H09+ TCCTCTTGAAAACAGAGGTATAAAGGGAAACAGACTGAAGGAATCAGCTTAGGAGAAACG
JMSF034P08+ TCCTCTTGAAAACAGAGGTATAAAGGGAAACAGACTGAAGGAATCAGCTTAGGAGAAACG
                      ____________________________________________________________
consensus TCCTCTTGAAAACAGAGGTATAAAGGGAAACAGACTGAAGGAATCAGCTTAGGAGAAACG
 
. : . : . : . : . : . :
JMFF010N04+ CCTTTGATGGGTCTCTGTGC
JMSF023J01+ CCTTTGATGGGTCTCT
JMFF041L17+ CCTTTGATGGGTCTCTGTGCTTTTGGCTTTTGGCTCAGAGATGATGCATATAT
JMFN031H09+ CCTTTGATGGGTCTCTGTGCTTTTGGCTTTTGGCTCAGAGATGATGCATATATGCACCGC
JMSF034P08+ CCTTTGATGGGTCTCTGTGCTTTTGGCTTTTGGCTCAGAGATGATGCATATATGCACCGC
                      ____________________________________________________________
consensus CCTTTGATGGGTCTCTGTGCTTTTGGCTTTTGGCTCAGAGATGATGCATATATGCACCGC
 
. : . : . : . : . : . :
JMFN031H09+ TACAGCGCGTAGGAGAATCTAAAAAGCCCCAAA
JMSF034P08+ TACAGCGCGTAGGAGAATCTAAAAAGCCCCAAATAAAGAATTGGGAAAAAAGAGGGTTCG
                      ____________________________________________________________
consensus TACAGCGCGTAGGAGAATCTAAAAAGCCCCAAATAAAGAATTGGGAAAAAAGAGGGTTCG
 
. : . : . : . : . : . :
JMSF034P08+ GGTTTTGGGTTGGCGTCGGTTAATGAAAGTACAATTATCAGTCATCAAAGGGCTCTCAAT
                      ____________________________________________________________
consensus GGTTTTGGGTTGGCGTCGGTTAATGAAAGTACAATTATCAGTCATCAAAGGGCTCTCAAT
 
. : . : . : . : . : . :
JMSF034P08+ TAGGGTTTCACTGCGTGGCTGCGAGAGATACGTGGGCGGGTTGGTTCCTTCAACTTGTCC
                      ____________________________________________________________
consensus TAGGGTTTCACTGCGTGGCTGCGAGAGATACGTGGGCGGGTTGGTTCCTTCAACTTGTCC