Previous Contig 006986:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF017H03Sequence262006986 (2)gb:AP005453_18520852e-10Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P045735011958 (2)gb:AP004840_18458229e-80Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P054
JMSF034O21Sequence613006986 (2)gb:AP004840_18458222e-46Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P054701011958 (2)gb:AP004840_18458222e-76Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P054

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034O21+ TAATCAGAGAGAC
                      ____________________________________________________________
consensus TAATCAGAGAGAC
 
. : . : . : . : . : . :
JMSF034O21+ CTTCNTCCTTAGAAGGCCAATCAGTGGTTTTACCCTTATTTTCACTGCTCCTAGGGGACC
                      ____________________________________________________________
consensus CTTCNTCCTTAGAAGGCCAATCAGTGGTTTTACCCTTATTTTCACTGCTCCTAGGGGACC
 
. : . : . : . : . : . :
JMSF034O21+ ATAAGCCTTCAACCACATCTTTCATTTTGTCACTGTCAGTCAAACTCGCTAACTCTTTCC
                      ____________________________________________________________
consensus ATAAGCCTTCAACCACATCTTTCATTTTGTCACTGTCAGTCAAACTCGCTAACTCTTTCC
 
. : . : . : . : . : . :
JMSF034O21+ GACTTCCTAGACTACGCATCATTTCATCCATTCTGAGAAATGATTTCTGAATTGAGGTGT
                      ____________________________________________________________
consensus GACTTCCTAGACTACGCATCATTTCATCCATTCTGAGAAATGATTTCTGAATTGAGGTGT
 
. : . : . : . : . : . :
JMSF034O21+ CTAACTCCCCGGCAGAATATGCTTCATGTCTGAGAAACTGCTGGTGAAGATACTTTGCAC
                      ____________________________________________________________
consensus CTAACTCCCCGGCAGAATATGCTTCATGTCTGAGAAACTGCTGGTGAAGATACTTTGCAC
 
. : . : . : . : . : . :
JMSF034O21+ AAAATTTAGCAACTTCATCACCTCCATGGCCATCATAAACACCAAAGAAAGCAGTGGAAG
                      ____________________________________________________________
consensus AAAATTTAGCAACTTCATCACCTCCATGGCCATCATAAACACCAAAGAAAGCAGTGGAAG
 
. : . : . : . : . : . :
JMSF017H03+ TGATGCACGCCATCCTTGCATTG
JMSF034O21+ CGTCCAGGTTTGGATAGGCTGCATGAGCATCTTCCATTGATGCACGCCATCCTTGCATTG
                      ____________________________________________________________
consensus CGTCCAGGTTTGGATAGGCTGCATGAGCATCTTCCATTGATGCACGCCATCCTTGCATTG
 
. : . : . : . : . : . :
JMSF017H03+ AAGCCAAGCCAAATTTTACTTTGTCATTCTCACCATCCTCCAAAAGCTTATCAGTTTTAG
JMSF034O21+ AAGCCAAGCCAAATTTTACTTTGTCATTCTCACCATCCTCCAAAAGCTTATCAGTTTTAG
                      ____________________________________________________________
consensus AAGCCAAGCCAAATTTTACTTTGTCATTCTCACCATCCTCCAAAAGCTTATCAGTTTTAG
 
. : . : . : . : . : . :
JMSF017H03+ GACTGCTTAGATATATCCCCATTTTCCGCCGCCAATGCAGAGACCGGTTTCGCTCCGGAT
JMSF034O21+ GACTGCTTAGATATATCCCCATTTTCCGCCGCCAATGCAGAGACCGGTTTCGCTCCGGAT
                      ____________________________________________________________
consensus GACTGCTTAGATATATCCCCATTTTCCGCCGCCAATGCAGAGACCGGTTTCGCTCCGGAT
 
. : . : . : . : . : . :
JMSF017H03+ AGAAATGCAAGCGAGAGAGAGAGAGAGAGGATCTGGAATTTAGTAAATGTGGGATCGGGT
JMSF034O21+ AGAAATGCAAGCGAGAGAGAGAGAGAGAGGATCTGGAATTTAGTAAATGTGGGATCGGGT
                      ____________________________________________________________
consensus AGAAATGCAAGCGAGAGAGAGAGAGAGAGGATCTGGAATTTAGTAAATGTGGGATCGGGT
 
. : . : . : . : . : . :
JMSF017H03+ TTGAGGGGAAGATGATTGATTGTAGTGGTTTGATTATTGTTATCTCAGGCTGAGCCGC
JMSF034O21+ TTGAGGGGAAGATGATTGATTGTAGTGGTTTGATTATTGTTATCTCAGGCTGAGCCGCTC
                      ____________________________________________________________
consensus TTGAGGGGAAGATGATTGATTGTAGTGGTTTGATTATTGTTATCTCAGGCTGAGCCGCTC