Previous Contig 006978:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN012G05Sequence623006978 (7)gb:AY295341_15962183e-20Cucumis sativus poly(A)-binding protein C-terminal interacting protein 6 mRNA, c
JMFN014L08Sequence627006978 (7)gb:AY295341_15962181e-24Cucumis sativus poly(A)-binding protein C-terminal interacting protein 6 mRNA, c
JMSF002B10Sequence219001781 (31)gb:AY832502_16299695e-17Pseudotsuga menziesii var. menziesii haplotype Pm-ERD15_2 early response to dehy732006978 (7)gb:AY295341_15962181e-24Cucumis sativus poly(A)-binding protein C-terminal interacting protein 6 mRNA, c
JMSF034N17Sequence684006978 (7)gb:AY832514_16299816e-16Pseudotsuga menziesii var. menziesii haplotype Pm-ERD15_14 early response to deh649006978 (7)gb:AY832514_16299812e-08Pseudotsuga menziesii var. menziesii haplotype Pm-ERD15_14 early response to deh
JMSF041E05Sequence797006978 (7)gb:AY832514_16299818e-16Pseudotsuga menziesii var. menziesii haplotype Pm-ERD15_14 early response to deh664006978 (7)gb:AY295341_15962183e-08Cucumis sativus poly(A)-binding protein C-terminal interacting protein 6 mRNA, c

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041E05+ TTTTTTTTTTGTGGAGAG
                      ____________________________________________________________
consensus TTTTTTTTTTGTGGAGAG
 
. : . : . : . : . : . :
rJMSF041E05- CACTTCTTACAGGAGATTACATGACTCGATA
rJMSF034N17- CACTTCTTACAGGAGATTACATGACTCGATA
JMSF041E05+ AATGATTAAACTCTTTTGGTTGTTTATTCAACTTCTTACAGGAGATTACATGACTCGATA
rJMSF002B10- CATGACTCGATA
                      ____________________________________________________________
consensus AATGATTAAACTCTTTTGGTTGTTTATTCCACTTCTTACAGGAGATTACATGACTCGATA
 
. : . : . : . : . : . :
rJMSF041E05- CGACTTCCAATTTCCAAACAGAAGACTGGCAGGGAACTACGTTAGCTTTAGGCAAGCAAG
rJMSF034N17- CGACTTCCAATTTCCAAACAGAAGACTGGCAGGGAACTACGTTAGCTTTAGGCAAGCAAG
JMSF041E05+ CGACTTCCAATTTCCAAACAGAAGACTGGCAGGGAACTACGTTAGCTTTAGGCAAGCAAG
JMFN012G05+ TTCCAAACAGAAGACTGGCAGGGAACTACGTTAGCTTTAGGCAAGCAAG
rJMSF002B10- CGACTTCCAATTTCCAAACAGAAGACTGGCAGGGAACTACGTTAGCTTTAGGCAAGCAAG
JMSF034N17+ ACTACGTTAGCTTTAGGCAAGCAAG
                      ____________________________________________________________
consensus CGACTTCCAATTTCCAAACAGAAGACTGGCAGGGAACTACGTTAGCTTTAGGCAAGCAAG
 
. : . : . : . : . : . :
rJMSF041E05- CAACTGTACAACAACAAGCCTAACAAAAGCTGAAATGAAAAGTTTGTTTATCCGACTCGG
rJMSF034N17- CAACTGTACAACAACAAGCCTAACAAAAGCTGAAATGAAAAGTTTGTTTATCCGACTCGG
JMSF041E05+ CAACTGTACAACAACAAGCCTAACAAAAGCTGAAATGAAAAGTTTGTTTATCCGACTCGG
JMFN014L08+ ACAACAACAAGCCTAACAAAAGCTGAAATGAAAAGTTTGTTTATCCGACTCGG
JMFN012G05+ CAACTGTACAACAACAAGCCTAACAAAAGCTGAAATGAAAAGTTTGTTTATCCGACTCGG
rJMSF002B10- CAACTGTACAACAACAAGCCTAACAAAAGCTGAAATGAAAAGTTTGTTTATCCGACTCGG
JMSF034N17+ CAACTGTACAACAACAAGCCTAACAAAAGCTGAAATGAAAAGTTTGTTTATCCGACTCGG
                      ____________________________________________________________
consensus CAACTGTACAACAACAAGCCTAACAAAAGCTGAAATGAAAAGTTTGTTTATCCGACTCGG
 
. : . : . : . : . : . :
rJMSF041E05- TACTAAGTAATGACCTAACTCAGTGAGTCAAGCAAACGAAACGATTACGATCCGCTCTAC
rJMSF034N17- TACTAAGTAATGACCTAACTCAGTGAGTCAAGCAAACGAAACGATTACGATCCGCTCTAC
JMSF041E05+ TACTAAGTAATGACCTAACTCAGTGAGTCAAGCAAACGAAACGATTACGATCCGCTCTAC
JMFN014L08+ TACTAAGTAATGACCTAACTCAGTGAGTCAAGCAAACGAAACGATTACGATCCGCTCTAC
JMFN012G05+ TACTAAGTAATGACCTAACTCAGTGAGTCAAGCAAACGAAACGATTACGATCCGCTCTAC
rJMSF002B10- TACTAAGTAATGACCTAACTCAGTGAGTCAAGCAAACGAAACGATTACGATCCGCTCTAC
JMSF034N17+ TACTAAGTAATGACCTAACTCAGTGAGTCAAGCAAACGAAACGATTACGATCCGCTCTAC
                      ____________________________________________________________
consensus TACTAAGTAATGACCTAACTCAGTGAGTCAAGCAAACGAAACGATTACGATCCGCTCTAC
 
. : . : . : . : . : . :
rJMSF041E05- CGCGGCTGCTGAATCGGCCTGGGGCTCACCTTCACATTCACGATCTTCGGCGCCTTCTTG
rJMSF034N17- CGCGGCTGCTGAATCGGCCTGGGGCTCACCTTCACATTCACGATCTTCGGCGCCTTCTTG
JMSF041E05+ CGCGGCTGCTGAATCGGCCTGGGGCTCACCTTCACATTCACGATCTTCGGCGCCTTCTTG
JMFN014L08+ CGCGGCTGCTGAATCGGCCTGGGGCTCACCTTCACATTCACGATCTTCGGCGCCTTCTTG
JMFN012G05+ CGCGGCTGCTGAATCGGCCTGGGGCTCACCTTCACATTCACGATCTTCGGCGCCTTCTTG
rJMSF002B10- CGCGGCTGCTGAATCGGCCTGGGGCTCACCTTCACATTCACGATCTTCGGCGCCTTCTTG
JMSF034N17+ CGCGGCTGCTGAATCGGCCTGGGGCTCACCTTCACATTCACGATCTTCGGCGCCTTCTTG
                      ____________________________________________________________
consensus CGCGGCTGCTGAATCGGCCTGGGGCTCACCTTCACATTCACGATCTTCGGCGCCTTCTTG
 
. : . : . : . : . : . :
rJMSF041E05- CCGTACTTGGGAATCTCCGCCGCGGCTCGCGGTTTCTGCCACTTCAAGGCTCCTAGAGTC
rJMSF034N17- CCGTACTTGGGAATCTCCGCCGCGGCTCGCGGTTTCTGCCACTTCAAGGCTCCTAGAGTC
JMSF041E05+ CCGTACTTGGGAATCTCCGCCGCGGCTCGCGGTTTCTGCCACTTCAAGGCTCCTAGAGTC
JMFN014L08+ CCGTACTTGGGAATCTCCGCCGCGGCTCGCGGTTTCTGCCACTTCAAGGCTCCTAGAGTC
JMFN012G05+ CCGTACTTGGGAATCTCCGCCGCGGCTCGCGGTTTCTGCCACTTCAAGGCTCCTAGAGTC
rJMSF002B10- CCGTACTTGGGAATCTCCGCCGCGGCTCGCGGTTTCTGCCACTTCAAGGCTCCTAGAGTC
JMSF034N17+ CCGTACTTGGGAATCTCCGCCGCGGCTCGCGGTTTCTGCCACTTCAAGGCTCCTAGAGTC
                      ____________________________________________________________
consensus CCGTACTTGGGAATCTCCGCCGCGGCTCGCGGTTTCTGCCACTTCAAGGCTCCTAGAGTC
 
. : . : . : . : . : . :
rJMSF041E05- ACCAGATCCGTCTTAGTCTCCTCCTCTTACATCCACCAAACACACACTCAGTTAGTTAGA
rJMSF034N17- ACCAGATCCGTCTTAGTCTCCTCCTCTTACATCCACCAAACACACACTCAGTTAGTTAGA
JMSF041E05+ ACCAGATCCGTCTTAGTCTCCTCCTCTTACATCCACCAAACACACACTCAGTTAGTTAGA
JMFN014L08+ ACCAGATCCGTCTTAGTCTCCTCCTC-TACATCCACCAAACACACACTCAGTTAGTTAGA
JMFN012G05+ ACCAGATCCGTCTTAGTCTCCTCCTC-TACATCCACCAAACACACACTCAGTTAGTTAGA
rJMSF002B10- ACCAGATCCGTCTTAGTCTCCTCCTC-TACATCCACCAAACACACACTCAGTTAGTTAGA
JMSF034N17+ ACCAGATCCGTCTTAGTCTCCTCCTCTTACATCCACCAAACACACACTCAGTTAGTTAGA
                      ____________________________________________________________
consensus ACCAGATCCGTCTTAGTCTCCTCCTCTTACATCCACCAAACACACACTCAGTTAGTTAGA
 
. : . : . : . : . : . :
rJMSF041E05- AACACGAATCGAAATAGCTGGGGATAAAAAAAAACTCATGAACTTACGCTCGGTGTTACC
rJMSF034N17- AACACGAATCGAAATAGCTGGGGATAAAAAAAAACTCATGAACTTACGCTCGGTGTTACC
JMSF041E05+ AACACGAATCGAAATAGCTGGGGATAAAAAAAAACTCATGAACTTACGCTCGGTGTTACC
JMFN014L08+ AACACGAATCGAAATAGCTGGGGATAAAAAAAAACTCATGAACTTACGCTCGGTGTTACC
JMFN012G05+ AACACGAATCGAAATAGCTGGGGATAAAAAAAAACTCATGAACTTACGCTCGGTGTTACC
rJMSF002B10- AACACGAATCGAAATAGCTGGGGATAAAAAAAAACTCATGAACTTACGCTCGGTGTTACC
JMSF034N17+ AACACGAATCGAAATAGCTGGGGATAAAAAAAAACTCATGAACTTACGCTCGGTGTTACC
                      ____________________________________________________________
consensus AACACGAATCGAAATAGCTGGGGATAAAAAAAAACTCATGAACTTACGCTCGGTGTTACC
 
. : . : . : . : . : . :
rJMSF041E05- GGAGTCGCGGACCGTTCCGTCGGCGAAAGGATCGGAGTCGAAGCCGGAGAAATCGAAGTC
rJMSF034N17- GGAGTCGCGGACCGTTCCGTCGGCGAAAGGATCGGAGTCGAAGCCGGAGAAATCGAAGTC
JMSF041E05+ GGAGTCGCGGACCGTTCCGTCGGCGAAAGGATCGGAGTCGAAGCCGGAGAAATCGAAGTC
JMFN014L08+ GGAGTCGCGGACCGTTCCGTCGGCGAAAGGATCGGAGTCGAAGCCGGAGAAATCGAAGTC
JMFN012G05+ GGAGTCGCGGACCGTTCCGTCGGCGAAAGGATCGGAGTCGAAGCCGGAGAAATCGAAGTC
rJMSF002B10- GGAGTCGCGGACCGTTCCGTCGGCGAAAGGATCGGAGTCGAAGCCGGAGAAATCGAAGTC
JMSF034N17+ GGAGTCGCGGACCGTTCCGTCGGCGAAAGGATCGGAGTCGAAGCCGGAGAAATCGAAGTC
                      ____________________________________________________________
consensus GGAGTCGCGGACCGTTCCGTCGGCGAAAGGATCGGAGTCGAAGCCGGAGAAATCGAAGTC
 
. : . : . : . : . : . :
rJMSF041E05- GATATCGAAATCATCCAAGTCGGGGAAGGAGGAGTCCACATCGGCGTAGCACTCGCGGAG
rJMSF034N17- GATATCGAAATCATCCAAGTCGGGGAAGGAGGAGTCCACATCGGCGTAGCACTCGCGGAG
JMSF041E05+ GATATCGAAATCATCCAAGTCGGGGAAGGAGGAGTCCACATCGGCGTAGCACTCGCGGAG
JMFN014L08+ GATATCGAAATCATCCAAGTCGGGGAAGGAGGAGTCCACATCGGCGTAGCACTCGCGGAG
JMFN012G05+ GATATCGAAATCATCCAAGTCGGGGAAGGAGGAGTCCACATCGGCGTAGCACTCGCGGAG
rJMSF002B10- GATATCGAAATCATCCAAGTCGGGGAAGGAGGAGTCCACATCGGCGTAGCACTCGCGGAG
JMSF034N17+ GATATCGAAATCATCCAAGTCGGGGAAGGAGGAGTCCACATCGGCGTAGCACTCGCGGAG
                      ____________________________________________________________
consensus GATATCGAAATCATCCAAGTCGGGGAAGGAGGAGTCCACATCGGCGTAGCACTCGCGGAG
 
. : . : . : . : . : . :
rJMSF041E05- CCAGTAGTCGCGGAACCAGGGAGAGTTGCGGATGAGGTCCCCACCACTGGTCGGAGAAGT
rJMSF034N17- CCAGTAGTCGCGGAACCAGGGAGAGTTGCGGATGAGGT-CCCACCACTGGTCGGAGAAGT
JMSF041E05+ CCAGTAGTCGCGGAACCAGGGAGAGTTGCGGATGAGGT-CCCACCACTGGTCGGAGAAGT
JMFN014L08+ CCAGTAGTCGCGGAACCAGGGAGAGTTGCGGATGAGGT-CCCACCACTGGTCGGAGAAGT
JMFN012G05+ CCAGTAGTCGCGGAACCAGGGAGAGTTGCGGATGAGGT-CCCACCACTGGTCGGAGAAGT
rJMSF002B10- CCAGTAGTCGCGGAACCAGGGAGAGTTGCGGATGAGGT-CCCACCACTGGTCGGAGAAGT
JMSF034N17+ CCAGTAGTCGCGGAACCAGGGAGAGTTGCGGATGAGGT-CCCACCACTGGTCGGAGAAGT
                      ____________________________________________________________
consensus CCAGTAGTCGCGGAACCAGGGAGAGTTGCGGATGAGGT-CCCACCACTGGTCGGAGAAGT
 
. : . : . : . : . : . :
rJMSF041E05- CCTCCACCGCGCGATACGCCGACGGCACGAA
rJMSF034N17- CCTCCACCGCGCGATACG
JMSF041E05+ CCTCCACCGCGCGATACGCCGACGGCACGAAGATCGGAGCGTTTGGATTGAGCGTAGAGG
JMFN014L08+ CCTCCACCGCGCGATACGCCGACGGCACGAAGATCGGAGCGTTTGGATTGAGCGTAGAGG
JMFN012G05+ CCTCCACCGCGCGATACGCCGACGGCACGAAGATCG
rJMSF002B10- CCTCCACCGCGCGATACGCCGACGGCACGAAGATCGGAGCGTTTGGATTGAGCGTAGAGG
JMSF034N17+ CCTCCACCGCGCGATACGCCGACGGCACGAAGATCGGAGCGTTTGGATTGAGCGTAGAGG
                      ____________________________________________________________
consensus CCTCCACCGCGCGATACGCCGACGGCACGAAGATCGGAGCGTTTGGATTGAGCGTAGAGG
 
. : . : . : . : . : . :
JMSF041E05+ TCGCCATTTTTGGGATCGGAGAATTTGTTTTGGGAGAAAAAGGAAGGAAGGTTT
JMFN014L08+ TCGCCATTTTTGGGATCGGAGAATTTGTTTTGGGAG
rJMSF002B10- TCGCCATTTTTGGGATCGGAGAATTTGTTTTGGGAGAAAAAGNAAGGAAGGTTTTAGCT
JMSF034N17+ TCGCCATTTTTGGGATCGGAGAATTTGTTTTGGGAGAAAAAGGAAGGAAGGTTTCAGCCC
                      ____________________________________________________________
consensus TCGCCATTTTTGGGATCGGAGAATTTGTTTTGGGAGAAAAAGGAAGGAAGGTTTTAGCTC