Previous Contig 006974:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031H05Sequence462006974 (4)pir|H96732|H967327e-21hypothetical protein F15H11.7 [imported] - Arabidopsis thaliana>gb:AE005173_8946
JMSF034M22Sequence622006974 (4)pir|H96732|H967321e-39hypothetical protein F15H11.7 [imported] - Arabidopsis thaliana>gb:AE005173_8946652023641pir|H96732|H967322e-74hypothetical protein F15H11.7 [imported] - Arabidopsis thaliana>gb:AE005173_8946
JMSF038P13Sequence611006974 (4)pir|H96732|H967323e-55hypothetical protein F15H11.7 [imported] - Arabidopsis thaliana>gb:AE005173_8946810009657 (2)gb:AY518884_16109226e-36Brassica napus putative proteasome 20S beta1 subunit mRNA, partial cds.
JMSF051E13Sequence402020566pir|T09157|T091577e-31phosphoglucomutase precursor, chloroplast - spinach>gb:SOPGM_1715833 S.oleracea 753006974 (4)pir|H96732|H967325e-46hypothetical protein F15H11.7 [imported] - Arabidopsis thaliana>gb:AE005173_8946

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF051E13+ CCTCACTTTTTAAGTCATCTCATTCTTTAATTAGCATCACTT
                      ____________________________________________________________
consensus CCTCACTTTTTAAGTCATCTCATTCTTTAATTAGCATCACTT
 
. : . : . : . : . : . :
rJMSF051E13+ AGAGCGTCAAGCAAAACCCGTTGTTATTGTGAGGGAAAAAGTAGCTAAGGCTGTACAAGA
                      ____________________________________________________________
consensus AGAGCGTCAAGCAAAACCCGTTGTTATTGTGAGGGAAAAAGTAGCTAAGGCTGTACAAGA
 
. : . : . : . : . : . :
JMSF038P13+ CATGATGGAAGCATCGTA
rJMSF051E13+ CGTGGTTAGAGAAACTAATCGGTGACATGAATTTACACTGACCATGATGGAAGCATCGTA
JMSF034M22+ GGAAGCATNGTA
                      ____________________________________________________________
consensus CGTGGTTAGAGAAACTAATCGGTGACATGAATTTACACTGACCATGATGGAAGCATCGTA
 
. : . : . : . : . : . :
JMSF038P13+ CTGGAAGGGTGGCAGTACTGTACTCATGAAGCAAGCCGGTGTGGTTGCAAGTCCCATATC
rJMSF051E13+ CTGGAAGGGTGGCAGTACTGTACTCATGAAGCAAGCCGGTGTGGTTGCAAGTCCCATATC
JMSF034M22+ NNGGAAGGGTGGCAGTACNGTANTCANGAAGCAAGCCGGNGTGGTTGCAAGTCCCATATC
                      ____________________________________________________________
consensus CTGGAAGGGTGGCAGTACTGTACTCATGAAGCAAGCCGGTGTGGTTGCAAGTCCCATATC
 
. : . : . : . : . : . :
JMSF038P13+ AAACACCAAGCACCCAGCCTGACCCAACCCAGCGAACACAGCCGCACTCAAAGATTTCCC
rJMSF051E13+ AAACACCAAGCACCCAGCCTGACCCAACCCAGCGAACACAGCCGCACTCAAAGATTTCCC
JMSF034M22+ AAACACCAAGCACCCAGCNTGACCCAACCCAGCGAACACAGCCGCACTCAAAGATTTCCC
                      ____________________________________________________________
consensus AAACACCAAGCACCCAGCCTGACCCAACCCAGCGAACACAGCCGCACTCAAAGATTTCCC
 
. : . : . : . : . : . :
JMSF038P13+ TGAAATTNTAGGATCCATTCCCAGCGAAACCCTAACGCTTTCTACCACCGCCCCACCTCT
rJMSF051E13+ TGAAATTCTAGGATCCATTCCCAGCGAAACCCTAACGCTTTCTACCACCGCCCCACCTCT
JMFF031H05+ TTCCCAGCGAAACCCTAACGCTTTCTACCACCGCCCCACCTCT
JMSF034M22+ TGAAATTNTAGGATCCATTCCCAGCGAAACCCTAACGCTTTNTACCACCGCCCCACCTCT
                      ____________________________________________________________
consensus TGAAATTCTAGGATCCATTCCCAGCGAAACCCTAACGCTTTCTACCACCGCCCCACCTCT
 
. : . : . : . : . : . :
JMSF038P13+ CTCACTCTCTAACCCACTAATCACCCATTCACCAAAGCTCTCCGCTATTGCTTCCACGGC
rJMSF051E13+ CTCACTCTCTAACCCACTAATCACCCATTCACCAAAGCTCTCCGCTATTGCTTCCACGGC
JMFF031H05+ CTCACTCTCTAACCCACTAATCACCCATTCACCAAAGCTCTCCGCTATTGCTTCCACGGC
JMSF034M22+ CTCACTCTCTAACCCACTAATCACCCATTCACCAAAGCTCTCCGCTATTGCTTCCACGGC
                      ____________________________________________________________
consensus CTCACTCTCTAACCCACTAATCACCCATTCACCAAAGCTCTCCGCTATTGCTTCCACGGC
 
. : . : . : . : . : . :
JMSF038P13+ CGGCGGCGTTAGATCCACGCTCCGCCCTTTCTCCCCCTGCAGGGCAACCCCACGGACGTC
rJMSF051E13+ CGGCGGCGTTAGATCCACGCTCCGCCCTTTCTCCCCCTGCAGGGCAACCCCACGGACGTC
JMFF031H05+ CGGTGGCGTTAGATCCACGCTCCGCCCTTTCTCCCCCTGCAGGGCAACCCCACGGACGTC
JMSF034M22+ CGGCGGCGTTAGATCCACGCTCCGCCCTTTCTCCCCCTGCAGGGCAACCCCACGGACGTC
                      ____________________________________________________________
consensus CGGCGGCGTTAGATCCACGCTCCGCCCTTTCTCCCCCTGCAGGGCAACCCCACGGACGTC
 
. : . : . : . : . : . :
JMSF038P13+ CGACCCGTTCTGTAGCCTTCTAATCTTCTCCATCTCTTCATCCACTGCAACTTCATTGTG
rJMSF051E13+ CGACCCGTTCTGTAGCCTTCTAATCTTCTCCATCTCTTCATCCACTGCAACTTCATTGTG
JMFF031H05+ CGACCCGTTCTGTAGCCTTCTAATCTTCTCCATCTCTTCATCCACTGCAACTTCATTGTG
JMSF034M22+ CGACCCGTTCTGTAGCCTTCTAATCTTCTCCATCTCTTCATCAACTGCAACTTCATTGTG
                      ____________________________________________________________
consensus CGACCCGTTCTGTAGCCTTCTAATCTTCTCCATCTCTTCATCCACTGCAACTTCATTGTG
 
. : . : . : . : . : . :
JMSF038P13+ CTTATTAGCAGTTAACGACGACTCTACCCGCAACGAAAGCTTGATTTTTGGGAATGATTG
rJMSF051E13+ CTTATTAGCAGTTAACGACGACTCTACCCGCAACGAAAGCTTGATTTTTGGGAATGATTG
JMFF031H05+ CTTATTAGCAGTTAACGACGACTCTACCCGCAACGAAAGCTTGATTTTTGGGAATGATTG
JMSF034M22+ CTTATTAGCAGTTAACGACGACTCTACCCGCAACGAAAGCTTGATTTTTGGGAATGATTG
                      ____________________________________________________________
consensus CTTATTAGCAGTTAACGACGACTCTACCCGCAACGAAAGCTTGATTTTTGGGAATGATTG
 
. : . : . : . : . : . :
JMSF038P13+ AGCTATCCCAAGGCTTCTGTGGAGTGGTTTGTGTATGGGGAATGAAGGAAAGTTAGGTTT
rJMSF051E13+ AGCTATCCCAAGGCTTCTGTGGAGTGGTTTGTGTATGGGGAATGAAGGAAAGTTAGGTTT
JMFF031H05+ AGCTATCCCAAGGCTTCTGTGGAGTGGTTTGTGTATGGGGAATGAAGGAAAGTTAGGTTT
JMSF034M22+ AGCTATCCCAAGGCTTCTGTGGAGTGGTTTGTGTATGGGGAATGAAGGAAAGTTAGGTTT
                      ____________________________________________________________
consensus AGCTATCCCAAGGCTTCTGTGGAGTGGTTTGTGTATGGGGAATGAAGGAAAGTTAGGTTT
 
. : . : . : . : . : . :
JMSF038P13+ TGAAGCAATGGTTTGTAAAGATTGTGGTGTTGTAGAAGTGGAAGCCATTGTAAACGATTT
rJMSF051E13+ TGAAGCAATGGTTTGTAAAGATTGTGGTGTTGTAGAAGTGGAAGCCATTGTAAACGATTT
JMFF031H05+ TGAAGCAATGGTTTGTAAAGATTGTGGTGTTGTAGAAGTGGAAGCCATTGTAAACGATTT
JMSF034M22+ TGAAGCAATGGTTTGTAAAGATTGTGGTGTTGTAGAAGTGGAAGCCATTGTAAACGATTT
                      ____________________________________________________________
consensus TGAAGCAATGGTTTGTAAAGATTGTGGTGTTGTAGAAGTGGAAGCCATTGTAAACGATTT
 
. : . : . : . : . : . :
JMSF038P13+ CT
rJMSF051E13+ CTGCGGAAAATTTGGGTTGCAGCATGTATGTATGTAAAAGATATT
JMFF031H05+ CTGCGGAAAATTTGGGTTGCAGCATGTATGTATGTAAAAGATATTTGGAAGTGAACTCC
JMSF034M22+ CTGCGGAAAATTTGGGTTGCAGCATGTATGTATGTAAAAGATATTTGGAAGTGAACTCCC
                      ____________________________________________________________
consensus CTGCGGAAAATTTGGGTTGCAGCATGTATGTATGTAAAAGATATTTGGAAGTGAACTCCC