Previous Contig 006968:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF012G11Sequence473006968 (4)gb:AP005445_18518937e-41Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P002706006968 (4)gb:AP005445_18518931e-55Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P002
JMSF034M06Sequence724006968 (4)gb:AP005445_18518931e-55Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P002655006968 (4)gb:AP005445_18518939e-56Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P002

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF012G11- GGCTAACACACTGCAACAGAAGCCCAGCC
rJMSF012G11+ GGCTAACACACTGCAACAGAAGCCCAGCC
JMSF034M06- AGCC
                      ____________________________________________________________
consensus GGCTAACACACTGCAACAGAAGCCCAGCC
 
. : . : . : . : . : . :
JMSF012G11- CTAAAATTGTTCGATCAGCGAACTCAATTACTCAATTTCTTCTTCTCTGATTCGACGCTT
rJMSF034M06+ ATCAGCGAACTCAATTACTCAATTTCTTCTTCTCTGATTCGACGCTT
rJMSF012G11+ CTAAAATTGTTCGATCAGCGAACTCAATTACTCAATTTCTTCTTCTCTGATTCGACGCTT
JMSF034M06- CTAAAATTGTTCGATCAGCGAACTCAATTACTCAATTTCTTCTTCTCTGATTCGACGCTT
                      ____________________________________________________________
consensus CTAAAATTGTTCGATCAGCGAACTCAATTACTCAATTTCTTCTTCTCTGATTCGACGCTT
 
. : . : . : . : . : . :
JMSF012G11- CTTCTCTCAGTTCAGACTTCAGATCAGCTCCCTGGTTCAGGATGGTTGAGACGCTGTTTG
rJMSF034M06+ CTTCTCTCAGTTCAGACTTCAGATCAGCTCCCTGGTTCAGGATGGTTGAGACGCTGTTTG
rJMSF012G11+ CTTCTCTCAGTTCAGACTTCAGATCAGCTCCCTGGTTCAGGATGGTTGAGACGCTGTTTG
JMSF034M06- CTTCTCTCAGTTCAGACTTCAGATCAGCTCCCTGGTTCAGGATGGTTGAGACGCTGTTTG
                      ____________________________________________________________
consensus CTTCTCTCAGTTCAGACTTCAGATCAGCTCCCTGGTTCAGGATGGTTGAGACGCTGTTTG
 
. : . : . : . : . : . :
JMSF012G11- AGGATATTTTTACAGTAACTAACATAGACCCAGATGGGAAAAAGTTCGATAAAGTTAATC
rJMSF034M06+ AGGATATTTTTACAGTAACTAACATAGACCCAGATGGGAAAAAGTTCGATAAAGTTAATC
rJMSF012G11+ AGGATATTTTTACAGTAACTAACATAGACCCAGATGGGAAAAAGTTCGATAAAGTTAATC
JMSF034M06- AGGATATTTTTACAGTAACTAACATAGACCCAGATGGGAAAAAGTTCGATAAAGTTAATC
                      ____________________________________________________________
consensus AGGATATTTTTACAGTAACTAACATAGACCCAGATGGGAAAAAGTTCGATAAAGTTAATC
 
. : . : . : . : . : . :
JMSF012G11- GCATTGAGGCGAGGAGCGAGCAGTTTGAAATGTATATGCAGTTAGATATAAACACGGATA
rJMSF034M06+ GCATTGAGGCGAGGAGCGAGCAGTTTGAAATGTATATGCAGTTAGATATAAACACGGATA
rJMSF012G11+ GCATTGAGGCGAGGAGCGAGCAGTTTGAAATGTATATGCAGTTAGATATAAACACGGATA
JMSF034M06- GCATTGAGGCGAGGAGCGAGCAGTTTGAAATGTATATGCAGTTAGATATAAACACGGATA
                      ____________________________________________________________
consensus GCATTGAGGCGAGGAGCGAGCAGTTTGAAATGTATATGCAGTTAGATATAAACACGGATA
 
. : . : . : . : . : . :
JMSF012G11- TATATCCTATCCGCCAAGACGAGAAGTTTATGATGGTTCTGGCCTCCACATTAAACTTGG
rJMSF034M06+ TATATCCTATCCGCCAAGACGAGAAGTTTATGATGGTTCTGGCCTCCACATTAAACTTGG
rJMSF012G11+ TATATCCTATCCGCCAAGACGAGAAGTTTATGATGGTTCTGGCCTCCACATTAAACTTGG
JMSF034M06- TATATCCTATCCGCCAAGACGAGAAGTTTATGATGGTTCTGGCCTCCACATTAAACTTGG
                      ____________________________________________________________
consensus TATATCCTATCCGCCAAGACGAGAAGTTTATGATGGTTCTGGCCTCCACATTAAACTTGG
 
. : . : . : . : . : . :
JMSF012G11- ATGGGACACCAGATTCTGGTTACTTTCTTCAGGGAAACAGGAAATCGCTTGCTGACAAGT
rJMSF034M06+ ATGGGACACCAGATTCTGGTTACTTTCTTCAGGGAAACAGGAAATCGCTTGCTGACAAGT
rJMSF012G11+ ATGGGACACCAGATTCTGGTTACTTTCTTCAGGGAAACAGGAAATCGCTTGCTGACAAGT
JMSF034M06- ATGGGACACCAGATTCTGGTTACTTTCTTCAGGGAAACAGGAAATCGCTTGCTGACAAGT
                      ____________________________________________________________
consensus ATGGGACACCAGATTCTGGTTACTTTCTTCAGGGAAACAGGAAATCGCTTGCTGACAAGT
 
. : . : . : . : . : . :
JMSF012G11- TCGAGTACGTGATGCAAGGAAAGCTGTACAGGATATCAGAGGAAGGTTCGGGAAGGCTTG
rJMSF034M06+ TCGAGTACGTGATGCAAGGAAAGCTGTACAGGATATCAGAGGAAGGTTCGGGAAGGCTTG
rJMSF012G11+ TCGAGTACGTGATGCAAGGAAAGCTGTACAGGATATCAGAGGAAGGTTCGGGAAGGCTTG
JMSF034M06- TCGAGTACGTGATGCAAGGAAAGCTGTACAGGATATCAGAGGAAGGTTCGGGAAGGCTTG
                      ____________________________________________________________
consensus TCGAGTACGTGATGCAAGGAAAGCTGTACAGGATATCAGAGGAAGGTTCGGGAAGGCTTG
 
. : . : . : . : . : . :
JMSF012G11- CTAAAGCGGATCTATATGTTTCAT
rJMSF034M06+ CTAAAGCGGATCTATATGTTTCATTCGGTGGACTTCTGATGCAGCTGAGGGGAGATCCAT
rJMSF012G11+ CTAAAGCGGATCTATATGTTTCATTCGGTGGACTTCTGATGCAGCTGAGGGGAGATCCAT
JMSF034M06- CTAAAGCGGATCTATATGTTTCATTCGGTGGACTTCTGATGCAGCTGAGGGGAGATCCAT
                      ____________________________________________________________
consensus CTAAAGCGGATCTATATGTTTCATTCGGTGGACTTCTGATGCAGCTGAGGGGAGATCCAT
 
. : . : . : . : . : . :
rJMSF034M06+ CGATAGCAGCTAAATTCGAGCTCGACCAGAGGCTGTTCATTCTCATCAGGAAAGTTTGAA
rJMSF012G11+ CGATAGCAGCTAAATTCGAGCTCGACCAGAGGCTGTTCATTCTCATCAGGAAAGTTTGAA
JMSF034M06- CGATAGCAGCTAAATTCGAGCTCGACCAGAGGCTGTTCATTCTCATCAGGAAAGTTTGAA
                      ____________________________________________________________
consensus CGATAGCAGCTAAATTCGAGCTCGACCAGAGGCTGTTCATTCTCATCAGGAAAGTTTGAA
 
. : . : . : . : . : . :
rJMSF034M06+ GCCGAAGTCTTTTTTTCTGATGGATCCGATACTGTTGTTATCGGATGTTATTTGTCAGTC
rJMSF012G11+ GCCGAAGTCTTTTTTTCTGATGGATCCGATACTGTTGTTATCGGATGTTATTTGTCAGTC
JMSF034M06- GCCGAAGTCTTTTTTTCTGATGGATCCGATACTGTTGTTATCGGATGTTATTTGTCAGTC
                      ____________________________________________________________
consensus GCCGAAGTCTTTTTTTCTGATGGATCCGATACTGTTGTTATCGGATGTTATTTGTCAGTC
 
. : . : . : . : . : . :
rJMSF034M06+ TAACGTTTACGTTAACATTTGAAGTGTTAATGTTGAGCCTTTGGGCTTGTTCATGAACCA
rJMSF012G11+ TAACGTTTACGTTAACATTTGAAGTGTTAATGTTGAGCCTTTGGGCTTGTTCATGAACCA
JMSF034M06- TAACGTTTACGTTAACATTTGAAGTGTTAATGTTGAGCCTTTGGGCTTGTTCATGAA-CA
                      ____________________________________________________________
consensus TAACGTTTACGTTAACATTTGAAGTGTTAATGTTGAGCCTTTGGGCTTGTTCATGAACCA
 
. : . : . : . : . : . :
rJMSF034M06+ TGATGTAA
rJMSF012G11+ TGATGTAATGATAAAGA
JMSF034M06- TGATGTAATGATAAAGATGACAAAGTACTATGTTGTTTGCAGATGATGCTCTGTTGGCTC
                      ____________________________________________________________
consensus TGATGTAATGATAAAGATGACAAAGTACTATGTTGTTTGCAGATGATGCTCTGTTGGCTC