Previous Contig 006965:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF037H02Sequence509006965 (5)gb:AY085285_15703573e-38Arabidopsis thaliana clone 142725 mRNA, complete sequence.698006451 (7)gb:AY085285_15703572e-58Arabidopsis thaliana clone 142725 mRNA, complete sequence.
JMFF037H13Sequence512006965 (5)gb:AY085285_15703573e-47Arabidopsis thaliana clone 142725 mRNA, complete sequence.670006451 (7)gb:AY085285_15703571e-57Arabidopsis thaliana clone 142725 mRNA, complete sequence.
JMFN025A23Sequence620006965 (5)gb:AY085285_15703573e-64Arabidopsis thaliana clone 142725 mRNA, complete sequence.
JMSF034L21Sequence682006965 (5)pir|C96793|C967935e-29unknown protein F14G6.13 [imported] - Arabidopsis thaliana>gb:AE005173_895184 Ar670006451 (7)gb:AY085285_15703575e-58Arabidopsis thaliana clone 142725 mRNA, complete sequence.
JMSF037P19Sequence438019966347006965 (5)pir|C96793|C967930.005unknown protein F14G6.13 [imported] - Arabidopsis thaliana>gb:AE005173_895184 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF037P19- ATAGTCATGTCTATAGTTCTTCCAACAACGGACTATTACCATACACC
                      ____________________________________________________________
consensus ATAGTCATGTCTATAGTTCTTCCAACAACGGACTATTACCATACACC
 
. : . : . : . : . : . :
rJMSF037P19- AAAAAAAAATCATGAAAATATATACTACTTAATCAATACTAAGTAAGTATGCTTGATGCA
                      ____________________________________________________________
consensus AAAAAAAAATCATGAAAATATATACTACTTAATCAATACTAAGTAAGTATGCTTGATGCA
 
. : . : . : . : . : . :
rJMSF037P19- CCCCAAATAAGCCTCAAAATGCTCGCTGCACCCAAATAAGCCTCAAGATGGGCTGCCTTT
JMFN025A23+ ATGGGCTGCCTTT
                      ____________________________________________________________
consensus CCCCAAATAAGCCTCAAAATGCTCGCTGCACCCAAATAAGCCTCAAGATGGGCTGCCTTT
 
. : . : . : . : . : . :
rJMSF037P19- CTCTTTACAAACTGCAGGAATTATAATACGAAGCATGTTGCCCAAGTTCCC
JMFN025A23+ CTCTTTACAAACTGCAGGAATTATAATAAGAAGCATGTTGCCCAAGTTCCCTGCGGCACA
JMFF037H13+ TCTTTACAAACTGCAGGAATTATAATAAGAAGCATGTTGCCCAAGTTCCCTGCGGCACA
JMFF037H02+ TCTTTACAANCTGCAGGAATTATAATAAGAAGCATGTTGCCCAAGTTCCNTGCGGCACA
                      ____________________________________________________________
consensus CTCTTTACAAACTGCAGGAATTATAATAAGAAGCATGTTGCCCAAGTTCCCTGCGGCACA
 
. : . : . : . : . : . :
JMFN025A23+ ACAGCCCACAATAAGTCCTCGTAGATGTTGGGGAGCTCTTGCAACCTGAACAACAACCCA
JMFF037H13+ ACAGCCCACAATAAGTCCTCGTAGATGTTGGGGAGCTCTTGCAACCTGAACAACAACCCA
JMFF037H02+ ACAGCCCACAATAAGTCCTNGTAGATGTTGGGGAGCTCTTGCAACNTGAACAACAACCCA
JMSF034L21+ CTTGCAACCTGAACANCAACCCA
                      ____________________________________________________________
consensus ACAGCCCACAATAAGTCCTCGTAGATGTTGGGGAGCTCTTGCAACCTGAACAACAACCCA
 
. : . : . : . : . : . :
JMFN025A23+ -CCCAAGAATTGAACCAATCACAAATGTGACAAAGATGTTGAGAGGCATGAACCACATTT
JMFF037H13+ -CCCAAGAATTGAACCAATCACAAATGTGACAAAGATGTTGAGAGGCATGAACCACATTT
JMFF037H02+ NCCCAAGAATTGAACCAATCACAAATGTGACAAAGATGTTGAGAGGCATGAACCACATTT
JMSF034L21+ -CCCAAGAATTGAACCAATCACAAATGTGACAAAGATGTTGAGAGGCATGAACCACATTT
                      ____________________________________________________________
consensus -CCCAAGAATTGAACCAATCACAAATGTGACAAAGATGTTGAGAGGCATGAACCACATTT
 
. : . : . : . : . : . :
JMFN025A23+ TCATCATGCTTTCATATGTAATCGAATTGGCCAAGTTGCTGGAGACAAGCGATGGATTGA
JMFF037H13+ TCATCATGCTTTCATATGTAATCGAATTGGCCAAGTTGCTGGAGACAAGCGATGGATTGA
JMFF037H02+ TCATCATGCTTTCATATGTAATCGAATTGGCCAAGTTGCTGGAGACAAGCGATGGATTGA
JMSF034L21+ TCATCATGCTTTCATATGTAATCGAATTGGCCAAGTTGCTGGAGACAAGCGATGGATTGA
                      ____________________________________________________________
consensus TCATCATGCTTTCATATGTAATCGAATTGGCCAAGTTGCTGGAGACAAGCGATGGATTGA
 
. : . : . : . : . : . :
JMFN025A23+ ATACAAAAAATACAATATTATTTAAATGCTTCCTTGCTTCCTCTCCCAACAAATCATAAC
JMFF037H13+ ATACAAAAAATACAATATTATTTAAATGCTTCCTTGCTTCCTCTCCCAACAAATCATAAC
JMFF037H02+ ATACAAAAAATACAATATTATTTAAATGCTTCCTTGCTTCCTCTCCCAACAAATCATAAC
JMSF034L21+ ATACAAAAAATACAATATTATTTAAATGCTTCCTTGCTTCCTCTCCCAACAAATCATAAC
                      ____________________________________________________________
consensus ATACAAAAAATACAATATTATTTAAATGCTTCCTTGCTTCCTCTCCCAACAAATCATAAC
 
. : . : . : . : . : . :
JMFN025A23+ GTTCCAGCGCAAGAACTGATCCGAGTCCCGTCACCAGGAGCACTTTGAGGACTGGCATTG
JMFF037H13+ GTTCCAGCGCAAGAACTGATCCGAGTCCCGTCACCAGGAGCACTTTGAGGACTGGCATTG
JMFF037H02+ GTTCCAGCGCAAGAACTGATCCGAGTCCCGTCACCAGGAGCACTTTGAGGACTGGCATTG
JMSF034L21+ GTTCCAGCGCAAGAACTGATCCGAGTCCCGTCACCAGGAGCACTTTGAGGACTGGCATTG
                      ____________________________________________________________
consensus GTTCCAGCGCAAGAACTGATCCGAGTCCCGTCACCAGGAGCACTTTGAGGACTGGCATTG
 
. : . : . : . : . : . :
JMFN025A23+ ATGCAGCAACGAATAGATCCAAAATAGCCCCCATATCTGGATTCTCTCAGCAAGCTAGCT
JMFF037H13+ ATGCAGCAACGAATAGATCCAAAATAGCCCCCATATCTGGATTCTCTCAGCAAGCTAGCT
JMFF037H02+ ATGCAGCAACGAATAGATCCAAAATAGCCCCCATATCTGGATTCTCTCAGCAAGCTAGCT
JMSF034L21+ ATGCAGCAACGAATAGATCCAAAATAGCCCCCATATCTGGATTCTCTCAGCAAGCTAGCT
                      ____________________________________________________________
consensus ATGCAGCAACGAATAGATCCAAAATAGCCCCCATATCTGGATTCTCTCAGCAAGCTAGCT
 
. : . : . : . : . : . :
JMFN025A23+ AAATATTTAAATTCTCGTCACAACTGATCCAACTGCTAGCTCCACTCAGCTCAGCTCAGC
JMFF037H13+ AAATATTTAAATTCTCGTCACAACTGATCCAACTGCTAGCTCCACTCAGCTCAGCTCAGC
JMFF037H02+ AAATATTTAAATTCTCGTCACAACTGATCCAACTGCTAGCTCCACTCAGCTCAGCTCAGC
JMSF034L21+ AAATATTTAAATTCTCGTCACAACTGATCCAACTGCTAGCTCCACTCAGCTCAGCTCAGC
                      ____________________________________________________________
consensus AAATATTTAAATTCTCGTCACAACTGATCCAACTGCTAGCTCCACTCAGCTCAGCTCAGC
 
. : . : . : . : . : . :
JMFN025A23+ TCAGTC
JMFF037H13+ TCAGTCA
JMFF037H02+ TCAGTCA
JMSF034L21+ TCAGTCAGATATCTGATGCATAGTAGCATACAATAGGAAGAACGTCCCAGACAGAAATGC
                      ____________________________________________________________
consensus TCAGTCAGATATCTGATGCATAGTAGCATACAATAGGAAGAACGTCCCAGACAGAAATGC
 
. : . : . : . : . : . :
JMSF034L21+ GCATATCTTCCAGAAGTGCATGCATATATGAATATTCAGCCGGCGGCGATTCACTCCTTC
                      ____________________________________________________________
consensus GCATATCTTCCAGAAGTGCATGCATATATGAATATTCAGCCGGCGGCGATTCACTCCTTC
 
. : . : . : . : . : . :
JMSF034L21+ CTCCTCCTCCGCCAGTTTGCACGTCGGAAACTTAAATGTAAATCCGGCGAATATATTGTT
                      ____________________________________________________________
consensus CTCCTCCTCCGCCAGTTTGCACGTCGGAAACTTAAATGTAAATCCGGCGAATATATTGTT
 
. : . : . : . : . : . :
JMSF034L21+ CAACTACNGACGAATCATGCTCAAATCACACCTTCAATCCTTCTTATTATTGAAGTTTAT
                      ____________________________________________________________
consensus CAACTACNGACGAATCATGCTCAAATCACACCTTCAATCCTTCTTATTATTGAAGTTTAT
 
. : . : . : . : . : . :
JMSF034L21+ AAGAATAACTTTCTTTGGAAAAAAAGTTTATAAGAATAATATAATGCTAGTTTAATAACC
                      ____________________________________________________________
consensus AAGAATAACTTTCTTTGGAAAAAAAGTTTATAAGAATAATATAATGCTAGTTTAATAACC