Previous Contig 006948:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044B18Sequence623006948 (5)gb:AB006701_15099329e-08Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOP9.608010392 (2)
JMFS093D03Sequence615006948 (5)gb:AB006701_15099328e-08Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOP9.
JMFS150A09Sequence601006948 (5)gb:AB006701_15099321e-07Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOP9.
JMSF017P12Sequence461006948 (5)705010392 (2)
JMSF034H19Sequence617006948 (5)259023621

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS093D03+ GATGATCCAGATTTGCACTTGTACATAGGAAGGCCTCATNTGAACCTGGCT
JMFF044B18+ GATCCAGATTTGCACTTGTACATAGGAAGGCCTCATTTGAACCTGGCT
                      ____________________________________________________________
consensus GATGATCCAGATTTGCACTTGTACATAGGAAGGCCTCATTTGAACCTGGCT
 
. : . : . : . : . : . :
JMFS093D03+ CTTCTAATGAACCCATAGCATCAACAGATGAACTTGGAACAGAAGATTGGCTACAAGAAA
JMFF044B18+ CTTCTAATGAACCCATAGCATCAACAGATGAACTTGGAACAGAAGATTGGCTACAAGAAA
                      ____________________________________________________________
consensus CTTCTAATGAACCCATAGCATCAACAGATGAACTTGGAACAGAAGATTGGCTACAAGAAA
 
. : . : . : . : . : . :
JMFS093D03+ ATTCACCTTGAAAAATTGGGTTTCTCAGCACAGCCCCAGTGCTCTCATTAATTCTATCAT
JMFF044B18+ ATTCACCTTGAAAAATTGGGTTTCTCAGCACAGCCCCAGTGCTCTCATTAATTCTATCAT
                      ____________________________________________________________
consensus ATTCACCTTGAAAAATTGGGTTTCTCAGCACAGCCCCAGTGCTCTCATTAATTCTATCAT
 
. : . : . : . : . : . :
JMFS093D03+ TCTCTCTGCAGAGGGCACTAGAGCCGCAATCTAAATCAGATCCGATCCATTCAAGGAATT
JMFF044B18+ TCTCTCTGCAGAGGGCACTAGAGCCGCAATCTAAATCAGATCCGATCCATTCAAGGAATT
JMFS150A09+ AAATCAGATCCGATCCATTCAAGGAATT
                      ____________________________________________________________
consensus TCTCTCTGCAGAGGGCACTAGAGCCGCAATCTAAATCAGATCCGATCCATTCAAGGAATT
 
. : . : . : . : . : . :
JMFS093D03+ TCGTGCGGCGCTCTCTAATACTTTTGGGACTTCTAACCCACACATCATATTGGTAGCTTC
JMFF044B18+ TCGTGCGGCGCTCTCTAATACTTTTGGGACTTCTAACCCACACATCATATTGGTAGCTTC
JMFS150A09+ TCGGGCGGCGCTCTCTAATACTTTTGGGACTTCTAACCCACACATCATATTGGTAGCTTC
JMSF034H19+ ATCATATTGGTAGCTTC
                      ____________________________________________________________
consensus TCGTGCGGCGCTCTCTAATACTTTTGGGACTTCTAACCCACACATCATATTGGTAGCTTC
 
. : . : . : . : . : . :
JMFS093D03+ TGGAGACACAATGATCAACCCATACATTAGACTCCAGGCAATTAGGACTTGCAGCAGATG
JMFF044B18+ TGGAGACACAATGATCAACCCATACATTAGACTCCAGGCAATTAGGACTTGCAGCAGATG
JMFS150A09+ TGGAGACACAATGATCAACCCATACATTAGACTCCAGGCAATTAGGACTTGCAGCAGATG
JMSF034H19+ TGGAGACACANTGATCAACCCATACATTAGACTCCAGGCANTTAGGACTTGCAGCAGATG
                      ____________________________________________________________
consensus TGGAGACACAATGATCAACCCATACATTAGACTCCAGGCAATTAGGACTTGCAGCAGATG
 
. : . : . : . : . : . :
JMFS093D03+ GCTGGACAATACTCTCCGGGGCATCAAAAAACTGACAATCCTCTTCATCCTGGCGGAAGC
JMFF044B18+ GCTGGACAATACTCTCCGGGGCATCAAAAAACTGACAATCCTCTTCATCCTGGCGGAAGC
JMFS150A09+ GCTGGACAATACTCTCCGGGGCATCAAAAAACTGACAATCCTCTTCATCCTGGCGGAAGC
JMSF034H19+ GCTGGACANTACTCTCCGGGGCATCAAAAAACTGACANTCNTCTTCATCCNGGCGGAAGC
                      ____________________________________________________________
consensus GCTGGACAATACTCTCCGGGGCATCAAAAAACTGACAATCCTCTTCATCCTGGCGGAAGC
 
. : . : . : . : . : . :
JMFS093D03+ TACCCATTATACCTTGAGTTCACCCCATGAAATCCAACCCTCAAGACATAACTTTTAAAG
JMFF044B18+ TACCCATTATACCTTGAGTTCACCCCATGAAATCCAACCCTCAAGACATAACTTTTAAAG
JMFS150A09+ TACCCATTATACCTTGAGTTCACCCCATGAAATCCAACCCTCAAGACATAACTTTTAAAG
JMSF017P12+ TTGAGTTCACCCCANGAAATCCAACCCTCANGACATAACTTTTAAAG
JMSF034H19+ TACCCANTATACCNTGAGTTCNCCCCANGAAATCCANCCCTCANGACATAACTTTTAAAG
                      ____________________________________________________________
consensus TACCCATTATACCTTGAGTTCACCCCATGAAATCCAACCCTCAAGACATAACTTTTAAAG
 
. : . : . : . : . : . :
JMFS093D03+ CCCTAGACAATGTGCTCAATTCCTTCCTTTATAATAATGGAACATTGGTATATTTTGCTT
JMFF044B18+ CCCTAGACAATGTGCTCAATTCCTGCCTTTATAATAATGGAACATTGGTATATTTTGCTT
JMFS150A09+ CCCTAGACAATGTGCTCAATTCCTTCCTTTATAATAATGGAACATTGGTATATTTTGCTT
JMSF017P12+ CCCTAGACAATGTGCTCAATTCCTTCCNTTATAATAATGGAACANTGGTATATTTTGCTT
JMSF034H19+ CCCTAGACAATGTGCTCANTTCCTTCCTTTATAATAATGGAACACTGGTATATTTTGCTT
                      ____________________________________________________________
consensus CCCTAGACAATGTGCTCAATTCCTTCCTTTATAATAATGGAACATTGGTATATTTTGCTT
 
. : . : . : . : . : . :
JMFS093D03+ CTTAACAGTATTGAATCAGGCGTAATAGAACAAGAGATTTTAGCAGCTCATGTTCCGGAA
JMFF044B18+ CTTAACAGTATTGAATCAGGCGTAATAGAACAAGAGATTTTAGCAGCTCATGTTCCGGAA
JMFS150A09+ CTTAACAGTATTGAATCAGGCGTAATAGAACAAGAGATTTTAGCAGCTCATGTTCCGGAA
JMSF017P12+ CTTAACANTATTGAATCAGGCGTAATAGAACANGAGATTTTAGCAGCTCATGTTCCGGAA
JMSF034H19+ CTTAACANTATTGAATCAGGCGTAATAGAACANGAGATTTTAGCAGCTCANGTTCCGGAA
                      ____________________________________________________________
consensus CTTAACAGTATTGAATCAGGCGTAATAGAACAAGAGATTTTAGCAGCTCATGTTCCGGAA
 
. : . : . : . : . : . :
JMFS093D03+ GAAGAGAACACAGTTACTCATGTG
JMFF044B18+ GAAGAGAACACAGTTACTCATGTGCCTCTTCCC
JMFS150A09+ GAAGAGAACACAGTTACTCATGTGCCTCTTCCCTGCGCTCATTCAGCAAAGAAGAGAGTG
JMSF017P12+ GAAGAGAACACANTTACTCATGTGCCTCTTCCCTGCGCTCATTCAGCAAAGAAGAGAGTG
JMSF034H19+ GAAGAGAACACANTTACTCATGTGCCTCTTCCCNGCGCTCANTCAGCAAAGAAGAGAGTG
                      ____________________________________________________________
consensus GAAGAGAACACAGTTACTCATGTGCCTCTTCCCTGCGCTCATTCAGCAAAGAAGAGAGTG
 
. : . : . : . : . : . :
JMFS150A09+ CTGACCATTAAAAGATGGGGAGGAAAAACTTGTGTAATTAATGGCGGAAGACGGGGTGAA
JMSF017P12+ CTGACCANTAAAAGATGGGGAGGAAAAACTTGTGTAATTAATGGCGGAAGACGGGGTGAA
JMSF034H19+ CTGACCANTAAAAGATGGGGAGGAAAAACTTGTGTANTTAATGGCGGAAGACGGGGTGAA
                      ____________________________________________________________
consensus CTGACCATTAAAAGATGGGGAGGAAAAACTTGTGTAATTAATGGCGGAAGACGGGGTGAA
 
. : . : . : . : . : . :
JMFS150A09+ ATTCGGAAAGTTGGAAAATTAAAATGGAAAAACTAATTTTGGAAGGAGAAAGTGAAATTT
JMSF017P12+ ATTCGGAAAGTTGGAAAATTAAAATGGAAAAACTAATTTTGGAAGGAGAAAGTGAAATTT
JMSF034H19+ ATTCNGAAAGTTGGAAAATTAAAATGGAAAAACTANTTTTGGAAGGAGAAAGTGAAATTT
                      ____________________________________________________________
consensus ATTCGGAAAGTTGGAAAATTAAAATGGAAAAACTAATTTTGGAAGGAGAAAGTGAAATTT
 
. : . : . : . : . : . :
JMFS150A09+ TCATAGATATTCGTGATTAACGGGCCCGAGAAA
JMSF017P12+ TCATAGATATTCGTGATTAACGGGCCCGAGAAACGAGATTTCGAGAC----GAGAGAGAG
JMSF034H19+ TCNTAGATATTCGTGATTAACGGGCCCGNGAAACGAGATTTCGAGACGAGAGAGAGAGAG
                      ____________________________________________________________
consensus TCATAGATATTCGTGATTAACGGGCCCGAGAAACGAGATTTCGAGACGAGAGAGAGAGAG
 
. : . : . : . : . : . :
JMSF017P12+ AGAGAGAGAGAGAGAGGTCTGAGACTCTCTGGTTAATGGTTATGCGTAGAGAGGCTG
JMSF034H19+ AGAGAGAGAGAGAGAGGTCTGAGACTCTCTGGTTAATGGTTATGCGTAGAGAGGCTGGCC
                      ____________________________________________________________
consensus AGAGAGAGAGAGAGAGGTCTGAGACTCTCTGGTTAATGGTTATGCGTAGAGAGGCTGGCC