Previous Contig 006943:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF034G01Sequence730006943 (2)gb:AP002047_18216421e-59Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MQC3.755013456 (4)gb:AP002047_18216423e-36Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MQC3.
JMSF043A14Sequence485006943 (2)gb:AP002047_18216421e-26Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MQC3.637013456 (4)gb:AP002047_18216421e-10Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MQC3.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034G01+ TTCAGGGTCA
                      ____________________________________________________________
consensus TTCAGGGTCA
 
. : . : . : . : . : . :
JMSF034G01+ TGTTCCATAGCACNTGCACGATGNCATGATGTCCNTGACTTGCAGCTATATGCAAAGGAT
                      ____________________________________________________________
consensus TGTTCCATAGCACNTGCACGATGNCATGATGTCCNTGACTTGCAGCTATATGCAAAGGAT
 
. : . : . : . : . : . :
JMSF034G01+ CAAATAGTGATCGGTTCTTCTTAGTGAGAGTTTCCTTAGTTGAGTACTTCAACAATTCTT
                      ____________________________________________________________
consensus CAAATAGTGATCGGTTCTTCTTAGTGAGAGTTTCCTTAGTTGAGTACTTCAACAATTCTT
 
. : . : . : . : . : . :
JMSF034G01+ TTACCACTTCAAGATGCCCCTTATCAGCTGCTGTAAACAATGCTGTCTCCCCTAATTCAT
                      ____________________________________________________________
consensus TTACCACTTCAAGATGCCCCTTATCAGCTGCTGTAAACAATGCTGTCTCCCCTAATTCAT
 
. : . : . : . : . : . :
JMSF043A14+ CTGTCAAATTCAGCTCCAC
JMSF034G01+ TCACCTCATTCACGACAGATTCCCTAATCTCTGCTACCTCTCTGTCAAATTCAGCTCCAC
                      ____________________________________________________________
consensus TCACCTCATTCACGACAGATTCCCTAATCTCTGCTACCTCTCTGTCAAATTCAGCTCCAC
 
. : . : . : . : . : . :
JMSF043A14+ TCAACATCCCAACCATTTGAGAATCAATATCATCAAGTATTTGCTTCACCGCTGCAAGAT
JMSF034G01+ TCAACATCCCAACCATTTGAGAATCAATATCATCAAGTATTTGCTTCACCGCTGCAAGAT
                      ____________________________________________________________
consensus TCAACATCCCAACCATTTGAGAATCAATATCATCAAGTATTTGCTTCACCGCTGCAAGAT
 
. : . : . : . : . : . :
JMSF043A14+ CACCTTTTTGAGCAGCCAAGTGAAGCTCCGTATCATTGTGCCTGCCCGTCACTTGTTTCA
JMSF034G01+ CACCTTTTTGAGCAGCCAAGTGAAGCTCCGTATCATTGTGCCTGCCCGTCACTTGTTTCA
                      ____________________________________________________________
consensus CACCTTTTTGAGCAGCCAAGTGAAGCTCCGTATCATTGTGCCTGCCCGTCACTTGTTTCA
 
. : . : . : . : . : . :
JMSF043A14+ CATATTTCTTTTTCCCTGCTTGATCAATTCGTTTACCAGAATTTGAAAGCACTAGAGCAG
JMSF034G01+ CATATTTCTTTTTCCCTGCTTGATCAATTCGTTTACCAGAATTTGAAAGCACTAGAGCAG
                      ____________________________________________________________
consensus CATATTTCTTTTTCCCTGCTTGATCAATTCGTTTACCAGAATTTGAAAGCACTAGAGCAG
 
. : . : . : . : . : . :
JMSF043A14+ GTGCTGTTGCCGAGGATGGAGATGGGGTTGGTGATGGCTCAAATAAAGAATGTTGGCTGG
JMSF034G01+ GTGCTGTTGCCGAGGATGGAGATGGGGTTGGTGATGGCTCAAATAAAGAATGTTGGCTGG
                      ____________________________________________________________
consensus GTGCTGTTGCCGAGGATGGAGATGGGGTTGGTGATGGCTCAAATAAAGAATGTTGGCTGG
 
. : . : . : . : . : . :
JMSF043A14+ TTGCTGGACTAATCAAGCCTTTCTCTAAGTCTATTTCACCTTCTTGAACAGGCGAAGCCA
JMSF034G01+ TTGCTGGACTAATCAAGCCTTTCTCTAAGTCTATTTCACCTTCTTGAACAGGCGAAGCCA
                      ____________________________________________________________
consensus TTGCTGGACTAATCAAGCCTTTCTCTAAGTCTATTTCACCTTCTTGAACAGGCGAAGCCA
 
. : . : . : . : . : . :
JMSF043A14+ TGGCTGAGCTGAGAGGATACAGAAGGAAGCTTGATGGAGTTGAATTTTGAGTGTTCGATT
JMSF034G01+ TGGCTGAGCTGAGAGGATACAGAAGGAAGCTTGATGGAGTTGAATTTTGAGTGTTCGATT
                      ____________________________________________________________
consensus TGGCTGAGCTGAGAGGATACAGAAGGAAGCTTGATGGAGTTGAATTTTGAGTGTTCGATT
 
. : . : . : . : . : . :
JMSF043A14+ GAGATTTAAGAAATAACAGAACAGAAAGTAAAAGCGTTAGGGAAATGAAAGAAGAAAGAA
JMSF034G01+ GAGATTTAAGAAATAACAGAACAGAAAGTAAAAGCGTTAGGGAAATGAAAGAAGAAAGAA
                      ____________________________________________________________
consensus GAGATTTAAGAAATAACAGAACAGAAAGTAAAAGCGTTAGGGAAATGAAAGAAGAAAGAA
 
. : . : . : . : . : . :
JMSF043A14+ GAAGACAGAAAGGGGAAAGTGCTGTGAGAAGGATGTTTTGCAAG
JMSF034G01+ GAAGACAGAAAGGGGAAAGTGCTGTGAGAAGGATGTTTTGCAAGTGGCTCCTGAACACTC
                      ____________________________________________________________
consensus GAAGACAGAAAGGGGAAAGTGCTGTGAGAAGGATGTTTTGCAAGTGGCTCCTGAACACTC